National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3903R-3 
 Symbol Gli  Full Name Gliotactin 
 CG No CG3903  Old CG No CG3903 
 Synonyms gli, CG3903, n(2)k09033, BG:DS09217.3, l(2)35Dg, l(2)br45, Gli 
 Accession No (Link to NCBI) NM_057254.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCCAGGCGATCCGGATTACAG 
 Primer Seq. 3'
aatctagaggtaccGTGGACAGGCGGGTCCAAAGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCCAGGCGAT CCGGATTACA GAACCTACAC GTTCAACGAT CGCCGATATG GTCATTATCA 
0061 GCCAAATGGC TATGGAGCCA ACTATCCAGG CAGAAATCCA CCGGGACAAT ATCCACAGGG 
0121 AATGCCGAAT GAAGATCGCT TTCGATTTGA TCCGAACGAT CCGAATGCGA GAACCCAGTT 
0181 TCCGGGAGTG CTGGCCGGAT GGCGAGAGGA TTTGCAGGGC AAGCAGCGGC GGGATTCGTT 
0241 GACCCTGGAG CGGGATGTAT TCGTGACCAC CAACTATGGC CAGGTGCAGG GCTTTAAGGT 
0301 GTATATGTAC GACAATCCAG ATCCGAAGTC CTTCTATCGT CCCTACCACT CGACCGTGGA 
0361 TCGTGTGATG GGCGAGTGCT CGGTCTTCCT GGGCATTCCC TACGCCCTGC CGCCCACTTT 
0421 CGAGGGCAGG TTCAAGCCAC CACGCGTCCA TCGAGGATGG CAGCTGCTGC AGGCCGTCGA 
0481 CTTTGGACCC GCCTGTCCAC  
 in silico PCR Fragment
0001 TCCAGGCGAT CCGGATTACA GAACCTACAC GTTCAACGAT CGCCGATATG GTCATTATCA 
0061 GCCAAATGGC TATGGAGCCA ACTATCCAGG CAGAAATCCA CCGGGACAAT ATCCACAGGG 
0121 AATGCCGAAT GAAGATCGCT TTCGATTTGA CCCGAACGAT CCGAATGCGA GAACCCAGTT 
0181 TCCGGGAGTG CTGGCCGGAT GGCGAGAGGA TTTGCAGGGC AAGCAGCGGC GGGATTCGTT 
0241 GACCCTGGAG CGGGATGTTT TCGTGACCAC CAACTATGGC CAGGTGCAGG GCTTTAAGGT 
0301 GTACATGTAC GATAATCCAG ATCCGAAGTC CTTCTATCGT CCCTACCACT CGACCGTGGA 
0361 TCGTGTGATG GGCGAGTGCT CGGTCTTCCT GGGCATTCCC TACGCCCTGC CGCCCACCTT 
0421 CGAGGGCAGG TTCAAGCCAC CACGCGTCCA TCGAGGCTGG CAGCTGCTGC AGGCCGTCGA 
0481 CTTTGGACCC GCCTGTCCAC  
 Assemble Data

3903R-3.IR_full       1   TCCAGGCGATCCGGATTACAGAACCTACACGTTCAACGATCGCCGATATGGTCATTATCA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3903R-3.in silico     1   TCCAGGCGATCCGGATTACAGAACCTACACGTTCAACGATCGCCGATATGGTCATTATCA 60


3903R-3.IR_full       61  GCCAAATGGCTATGGAGCCAACTATCCAGGCAGAAATCCACCGGGACAATATCCACAGGG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3903R-3.in silico     61  GCCAAATGGCTATGGAGCCAACTATCCAGGCAGAAATCCACCGGGACAATATCCACAGGG 120


3903R-3.IR_full       121 AATGCCGAATGAAGATCGCTTTCGATTTGATCCGAACGATCCGAATGCGAGAACCCAGTT 180
                          |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
3903R-3.in silico     121 AATGCCGAATGAAGATCGCTTTCGATTTGACCCGAACGATCCGAATGCGAGAACCCAGTT 180


3903R-3.IR_full       181 TCCGGGAGTGCTGGCCGGATGGCGAGAGGATTTGCAGGGCAAGCAGCGGCGGGATTCGTT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3903R-3.in silico     181 TCCGGGAGTGCTGGCCGGATGGCGAGAGGATTTGCAGGGCAAGCAGCGGCGGGATTCGTT 240


3903R-3.IR_full       241 GACCCTGGAGCGGGATGTATTCGTGACCACCAACTATGGCCAGGTGCAGGGCTTTAAGGT 300
                          |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
3903R-3.in silico     241 GACCCTGGAGCGGGATGTTTTCGTGACCACCAACTATGGCCAGGTGCAGGGCTTTAAGGT 300


3903R-3.IR_full       301 GTATATGTACGACAATCCAGATCCGAAGTCCTTCTATCGTCCCTACCACTCGACCGTGGA 360
                          ||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||
3903R-3.in silico     301 GTACATGTACGATAATCCAGATCCGAAGTCCTTCTATCGTCCCTACCACTCGACCGTGGA 360


3903R-3.IR_full       361 TCGTGTGATGGGCGAGTGCTCGGTCTTCCTGGGCATTCCCTACGCCCTGCCGCCCACTTT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
3903R-3.in silico     361 TCGTGTGATGGGCGAGTGCTCGGTCTTCCTGGGCATTCCCTACGCCCTGCCGCCCACCTT 420


3903R-3.IR_full       421 CGAGGGCAGGTTCAAGCCACCACGCGTCCATCGAGGATGGCAGCTGCTGCAGGCCGTCGA 480
                          |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
3903R-3.in silico     421 CGAGGGCAGGTTCAAGCCACCACGCGTCCATCGAGGCTGGCAGCTGCTGCAGGCCGTCGA 480


3903R-3.IR_full       481 CTTTGGACCCGCCTGTCCAC 500
                          ||||||||||||||||||||
3903R-3.in silico     481 CTTTGGACCCGCCTGTCCAC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057254.3  CG3903-RA, transcript variant A (Gli), mRNA 
100   482  NM_165128.1  CG3903-RD, transcript variant D (Gli), mRNA 
100   482  NM_165127.1  CG3903-RC, transcript variant C (Gli), mRNA 
100   482  NM_165129.1  CG3903-RE, transcript variant E (Gli), mRNA 
68.04   328  NM_165130.1  CG3903-RB, transcript variant B (Gli), mRNA 
0.2   NM_137125.2  CG12869-RA (CG12869), mRNA 
0.2   NM_167640.1  CG7990-RB, transcript variant B (CG7990), mRNA 
0   NM_078772.2  CG13772-RA (neuroligin), mRNA 
0   13  NM_079034.2  CG8425-RA (Jhe), mRNA 
0   NM_136391.2  CG9436-RA (CG9436), mRNA 
0   NM_078592.2  CG11172-RA (NFAT), mRNA 
0   NM_132656.1  CG1673-RA (CG1673), mRNA 
0   NM_136054.2  CG10341-RA (CG10341), mRNA 
0   NM_078756.3  CG14039-RA, transcript variant A (qtc), mRNA 
0   NM_001014467.1  CG14039-RE, transcript variant E (qtc), mRNA 
0   NM_001014469.1  CG14039-RF, transcript variant F (qtc), mRNA 
0   NM_164625.1  CG14039-RB, transcript variant B (qtc), mRNA 
0   NM_001014468.1  CG14039-RG, transcript variant G (qtc), mRNA 
0   NM_164627.1  CG14039-RC, transcript variant C (qtc), mRNA 
0   NM_164626.1  CG14039-RD, transcript variant D (qtc), mRNA 
0   NM_132347.1  CG3099-RB (CG3099), mRNA 
0   NM_138989.2  CG17174-RA (ACXB), mRNA 
0   NM_170371.1  CG9983-RE, transcript variant E (Hrb98DE), mRNA 
0   NM_170370.1  CG9983-RA, transcript variant A (Hrb98DE), mRNA 
0   NM_079819.2  CG9983-RB, transcript variant B (Hrb98DE), mRNA 
0   NM_170374.1  CG9983-RF, transcript variant F (Hrb98DE), mRNA 
0   NM_170372.1  CG9983-RC, transcript variant C (Hrb98DE), mRNA 
0   NM_170373.1  CG9983-RD, transcript variant D (Hrb98DE), mRNA 
0   NM_057279.4  CG8696-RA (LvpH), mRNA 
0   NM_132125.1  CG4536-RA (CG4536), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.