National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3891R-2 
 Symbol CG3891  Full Name CG3891 
 CG No CG3891  Old CG No CG3891 
 Synonyms CG3891 
 Accession No (Link to NCBI) NM_140056.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Mummery-Widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA.
Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi.
Nature (2009) 458(7241) 987-92 [ PubMed ID = 19363474 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGATACCAATGCCCATGCTGCCCACCGGAGCGGCGCAAATCATAATTGGCCAGCAGCCAC 60

                          ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| silico     61  AGGGTCAGGCGACGGCGACGGGTCTGCAGCCACAATTGATACCGCTGCAGGCCAACCAGA 120

                          |||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |||| silico     121 TTATGCTG-CAGGCTGCGCAGCAGCAGCCACAG-ATGCAGGTGATGCAGCTGCCCGATGG 180

                          ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| silico     181 CCAGACTATATTCTATCAGACGCCCACCATTGCCGCCTTGGATCCGA-ATGCAGCGGCCA 240

                          ||||| ||||||||| |||||| ||||||||||||||||||||||||||||||||||||| silico     241 ACGCC-GCAGCTGCC-ATGGCA-GCCCAGCCGACGCCGCACTACCTCAATATCAATGGGC 300

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| silico     301 AGCTGGTGCAGATCAATCCAGCACCGAGCGCTAATCAGGCGGCACCCACAGCTGGGCAAC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AGATTATAATGGTGCCGCAGACAGCGATGGCAGCGGTGAATGCAGCGGCCGCCAATGCCG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GAGTAGGCGCCGGAGTGGGCACAGTGGTTACCCAACAACAACAGCAGCAGCATCAACAAG 480

                          |||||||||||||||||||||||||| silico     481 TACAATCCCAGACCCAAAACCAGCAG 506

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  10  49  NM_140056.2  CG3891-RA (CG3891), mRNA 
2.28   11  12  54  120  NM_135615.2  CG6700-RA (CG6700), mRNA 
1.86   11  25  NM_078614.3  CG8544-RB, transcript variant B (sd), mRNA 
1.86   11  25  NM_167465.1  CG8544-RA, transcript variant A (sd), mRNA 
1.86   11  25  NM_206727.1  CG8544-RC, transcript variant C (sd), mRNA 
1.65   53  189  466  NM_168571.2  CG32133-RA (CG32133), mRNA 
1.24   35  133  351  NM_001038734.1  CG16902-RC (Hr4), mRNA 
1.24   32  127  234  NM_139799.3  CG10107-RA, transcript variant A (CG10107), mRNA 
1.24   32  127  234  NM_206286.1  CG10107-RC, transcript variant C (CG10107), mRNA 
1.24   23  121  314  NM_079903.2  CG15319-RB (nej), mRNA 
1.24   15  69  204  NM_176591.1  CG15532-RC, transcript variant C (hdc), mRNA 
1.24   15  69  204  NM_079853.2  CG15532-RA, transcript variant A (hdc), mRNA 
1.03   13  50  73  NM_057520.3  CG3497-RA (Su(H)), mRNA 
0.82   47  335  937  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0.82   47  335  937  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0.82   47  335  937  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0.82   34  97  214  NM_137690.2  CG10543-RA, transcript variant A (CG10543), mRNA 
0.82   34  95  193  NM_176241.1  CG10543-RC, transcript variant C (CG10543), mRNA 
0.82   34  95  193  NM_166416.1  CG10543-RB, transcript variant B (CG10543), mRNA 
0.82   33  86  204  NM_168179.1  CG32394-RA (CG32394), mRNA 
0.82   27  92  264  NM_078797.2  CG13109-RA (tai), mRNA 
0.82   22  73  159  NM_168413.1  CG32062-RB, transcript variant B (CG32062), mRNA 
0.82   22  73  159  NM_168412.1  CG32062-RD, transcript variant D (CG32062), mRNA 
0.82   22  46  108  NM_141639.1  CG16779-RA (CG16779), mRNA 
0.82   20  65  92  NM_057489.3  CG4722-RA (bib), mRNA 
0.82   19  77  169  NM_078523.2  CG2252-RB, transcript variant B (fs(1)h), mRNA 
0.82   17  128  215  NM_139493.2  CG2083-RA (CG2083), mRNA 
0.82   17  68  180  NM_137212.2  CG30089-RA (CG30089), mRNA 
0.82   16  55  142  NM_168237.1  CG17888-RD, transcript variant D (Pdp1), mRNA 
0.82   16  30  101  NM_079736.2  CG10868-RA, transcript variant A (orb), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.