National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3891R-1 
 Symbol CG3891  Full Name CG3891 
 CG No CG3891  Old CG No CG3891 
 Synonyms CG3891 
 Accession No (Link to NCBI) NM_140056.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Mummery-Widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA.
Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi.
Nature (2009) 458(7241) 987-92 [ PubMed ID = 19363474 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGATACCAATGCCCATGCTGC 
 Primer Seq. 3'
aatctagaggtaccCTGCTGGTTTTGGGTCTGGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGATACCAAT GCCCATGCTG CCCACCGGAG CGGCGCAAAT CATAATTGGC CAGCAGCCAC 
0061 AGGGTCAGGC GACCGCGACG GGTCTGCAGC CACAATTGAT ACCGCTGCAG GCCAACCAGA 
0121 TTATGCTGNC AGGCTGCGCA GCAGCAGCCA CAGNATGCAG GTGATGCAGC TGCCCNATGG 
0181 CCAGACTATA TTCTATCAGA CGCCCACCAT TGCCGCCTTG GATCCGANAT GCAGCGGCCA 
0241 ACGCCNGCag CTGCCNATGG CANGCCCAGC CGACGCCGCA CTACCTCAAT ATCAATGGGC 
0301 AGCTGGTGCA GATCAATCCA GCACCGAGCG CTAATCAGGC GGCACCCACA GCTGGTCAAC 
0361 AGATTATAAT GGTGCCGCAG ACAGCGATGG CAGCGGTGAA TGCAGCGGCC GCCAATGCCG 
0421 GAGTAGGCGC CGGAGTGGGC ACAGTGGTTA CCCAACAACA ACAGCAGCAG CATCAACAAG 
0481 TACAATCCCA GACCCAAAAC CAGCAG 
 in silico PCR Fragment
0001 TGATACCAAT GCCCATGCTG CCCACCGGAG CGGCGCAAAT CATAATTGGC CAGCAGCCAC 
0061 AGGGTCAGGC GACGGCGACG GGTCTGCAGC CACAATTGAT ACCGCTGCAG GCCAACCAGA 
0121 TTATGCTG-C AGGCTGCGCA GCAGCAGCCA CAG-ATGCAG GTGATGCAGC TGCCCGATGG 
0181 CCAGACTATA TTCTATCAGA CGCCCACCAT TGCCGCCTTG GATCCGA-AT GCAGCGGCCA 
0241 ACGCC-GCAG CTGCC-ATGG CA-GCCCAGC CGACGCCGCA CTACCTCAAT ATCAATGGGC 
0301 AGCTGGTGCA GATCAATCCA GCACCGAGCG CTAATCAGGC GGCACCCACA GCTGGGCAAC 
0361 AGATTATAAT GGTGCCGCAG ACAGCGATGG CAGCGGTGAA TGCAGCGGCC GCCAATGCCG 
0421 GAGTAGGCGC CGGAGTGGGC ACAGTGGTTA CCCAACAACA ACAGCAGCAG CATCAACAAG 
0481 TACAATCCCA GACCCAAAAC CAGCAG 
 Assemble Data

3891R-1.IR_full       1   TGATACCAATGCCCATGCTGCCCACCGGAGCGGCGCAAATCATAATTGGCCAGCAGCCAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3891R-1.in silico     1   TGATACCAATGCCCATGCTGCCCACCGGAGCGGCGCAAATCATAATTGGCCAGCAGCCAC 60


3891R-1.IR_full       61  AGGGTCAGGCGACCGCGACGGGTCTGCAGCCACAATTGATACCGCTGCAGGCCAACCAGA 120
                          ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
3891R-1.in silico     61  AGGGTCAGGCGACGGCGACGGGTCTGCAGCCACAATTGATACCGCTGCAGGCCAACCAGA 120


3891R-1.IR_full       121 TTATGCTGNCAGGCTGCGCAGCAGCAGCCACAGNATGCAGGTGATGCAGCTGCCCNATGG 180
                          |||||||| |||||||||||||||||||||||| ||||||||||||||||||||| ||||
3891R-1.in silico     121 TTATGCTG-CAGGCTGCGCAGCAGCAGCCACAG-ATGCAGGTGATGCAGCTGCCCGATGG 180


3891R-1.IR_full       181 CCAGACTATATTCTATCAGACGCCCACCATTGCCGCCTTGGATCCGANATGCAGCGGCCA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
3891R-1.in silico     181 CCAGACTATATTCTATCAGACGCCCACCATTGCCGCCTTGGATCCGA-ATGCAGCGGCCA 240


3891R-1.IR_full       241 ACGCCNGCAGCTGCCNATGGCANGCCCAGCCGACGCCGCACTACCTCAATATCAATGGGC 300
                          ||||| ||||||||| |||||| |||||||||||||||||||||||||||||||||||||
3891R-1.in silico     241 ACGCC-GCAGCTGCC-ATGGCA-GCCCAGCCGACGCCGCACTACCTCAATATCAATGGGC 300


3891R-1.IR_full       301 AGCTGGTGCAGATCAATCCAGCACCGAGCGCTAATCAGGCGGCACCCACAGCTGGTCAAC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
3891R-1.in silico     301 AGCTGGTGCAGATCAATCCAGCACCGAGCGCTAATCAGGCGGCACCCACAGCTGGGCAAC 360


3891R-1.IR_full       361 AGATTATAATGGTGCCGCAGACAGCGATGGCAGCGGTGAATGCAGCGGCCGCCAATGCCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3891R-1.in silico     361 AGATTATAATGGTGCCGCAGACAGCGATGGCAGCGGTGAATGCAGCGGCCGCCAATGCCG 420


3891R-1.IR_full       421 GAGTAGGCGCCGGAGTGGGCACAGTGGTTACCCAACAACAACAGCAGCAGCATCAACAAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3891R-1.in silico     421 GAGTAGGCGCCGGAGTGGGCACAGTGGTTACCCAACAACAACAGCAGCAGCATCAACAAG 480


3891R-1.IR_full       481 TACAATCCCAGACCCAAAACCAGCAG 506
                          ||||||||||||||||||||||||||
3891R-1.in silico     481 TACAATCCCAGACCCAAAACCAGCAG 506

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  10  49  NM_140056.2  CG3891-RA (CG3891), mRNA 
2.28   11  12  54  120  NM_135615.2  CG6700-RA (CG6700), mRNA 
1.86   11  25  NM_078614.3  CG8544-RB, transcript variant B (sd), mRNA 
1.86   11  25  NM_167465.1  CG8544-RA, transcript variant A (sd), mRNA 
1.86   11  25  NM_206727.1  CG8544-RC, transcript variant C (sd), mRNA 
1.65   53  189  466  NM_168571.2  CG32133-RA (CG32133), mRNA 
1.24   35  133  351  NM_001038734.1  CG16902-RC (Hr4), mRNA 
1.24   32  127  234  NM_139799.3  CG10107-RA, transcript variant A (CG10107), mRNA 
1.24   32  127  234  NM_206286.1  CG10107-RC, transcript variant C (CG10107), mRNA 
1.24   23  121  314  NM_079903.2  CG15319-RB (nej), mRNA 
1.24   15  69  204  NM_176591.1  CG15532-RC, transcript variant C (hdc), mRNA 
1.24   15  69  204  NM_079853.2  CG15532-RA, transcript variant A (hdc), mRNA 
1.03   13  50  73  NM_057520.3  CG3497-RA (Su(H)), mRNA 
0.82   47  335  937  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0.82   47  335  937  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0.82   47  335  937  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0.82   34  97  214  NM_137690.2  CG10543-RA, transcript variant A (CG10543), mRNA 
0.82   34  95  193  NM_176241.1  CG10543-RC, transcript variant C (CG10543), mRNA 
0.82   34  95  193  NM_166416.1  CG10543-RB, transcript variant B (CG10543), mRNA 
0.82   33  86  204  NM_168179.1  CG32394-RA (CG32394), mRNA 
0.82   27  92  264  NM_078797.2  CG13109-RA (tai), mRNA 
0.82   22  73  159  NM_168413.1  CG32062-RB, transcript variant B (CG32062), mRNA 
0.82   22  73  159  NM_168412.1  CG32062-RD, transcript variant D (CG32062), mRNA 
0.82   22  46  108  NM_141639.1  CG16779-RA (CG16779), mRNA 
0.82   20  65  92  NM_057489.3  CG4722-RA (bib), mRNA 
0.82   19  77  169  NM_078523.2  CG2252-RB, transcript variant B (fs(1)h), mRNA 
0.82   17  128  215  NM_139493.2  CG2083-RA (CG2083), mRNA 
0.82   17  68  180  NM_137212.2  CG30089-RA (CG30089), mRNA 
0.82   16  55  142  NM_168237.1  CG17888-RD, transcript variant D (Pdp1), mRNA 
0.82   16  30  101  NM_079736.2  CG10868-RA, transcript variant A (orb), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.