National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3869R-1 
 Symbol Marf  Full Name Mitochondrial assembly regulatory factor 
 CG No CG3869  Old CG No CG3869 
 Synonyms CG3869, dmfn, anon-WO0125274.3, Marf, MARF 
 Accession No (Link to NCBI) NM_132092.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees early pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Owusu-Ansah E, Song W, Perrimon N.
Muscle mitohormesis promotes longevity via systemic repression of insulin signaling.
Cell (2013) 155(3) 699-712 [ PubMed ID = 24243023 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCTCGATGGTGACCGGGCAAA 
 Primer Seq. 3'
aatctagaggtaccGCAGAAGCAATTCGTGGTGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCTCGATGGT GACCGGGCAA ACGGGCCCCG CCGACGACGA CCGTCACGCC TCCTCCACGG 
0061 ACACGGTGGA CAAATCCGGA CCCGGTTCCC CGCTATCCCG GTTCAACTCA TCGCTGCAAC 
0121 AATCCGGCTC CACAATGGCC GCCAATCTGC TACCGGAATC GCGGCTCTAT CAATCCAACG 
0181 ACAAATCACC GCTCCAGATC TTTGTGCGCG CCAAAAAGAA GATCAACGAT ATCTACGGCG 
0241 AGATCGAGGA GTATGTCCAT GAGACGACCA CCTTTATCAA CGCCCTGCAC GCGGAAGCGG 
0301 AGATCGTGGA CAAGGCGGAA CGGGAGCTGT TCGAAAGCTA TGTGTACAAG GTGGCGGCCA 
0361 TTCGCGAAGT ACTGCAGCGG GATCACATGA AGGTGGCCTT CTTTGGACGC ACCTCCAACG 
0421 GCAAGAGCTC GGTGATTAAT GCCATGTTGC GCGAGAAGAT CCTGCCCAGC GGCATTGGGC 
0481 ACACCACGAA TTGCTTTCTG C 
 in silico PCR Fragment
0001 TCTCGATGGT GACCGGGCAA ACGGGCCCCG CCGACGACGA CCGTCACGCC TCCTCCACGG 
0061 ACACGGTGGA CAAATCCGGA CCCGGTTCCC CGCTATCCCG GTTCAACTCA TCGCTGCAAC 
0121 AATCCGGCTC CACAATGGCC GCCAATCTGC TACCGGAATC GCGGCTCTAT CAATCCAACG 
0181 ACAAATCACC GCTCCAGATC TTTGTGCGCG CCAAAAAGAA GATCAACGAT ATCTACGGCG 
0241 AGATCGAGGA GTATGTCCAT GAGACGACCA CCTTTATCAA CGCCCTGCAC GCGGAAGCGG 
0301 AGATCGTGGA CAAGGCGGAA CGGGAGCTGT TCGAAAGCTA TGTGTACAAG GTGGCGGCCA 
0361 TTCGCGAAGT ACTGCAGCGG GATCACATGA AGGTGGCCTT CTTTGGACGC ACCTCCAACG 
0421 GCAAGAGCTC GGTGATTAAT GCCATGTTGC GCGAGAAGAT CCTGCCCAGC GGCATTGGGC 
0481 ACACCACGAA TTGC-TTCTG C 
 Assemble Data

3869R-1.IR_full       1   TCTCGATGGTGACCGGGCAAACGGGCCCCGCCGACGACGACCGTCACGCCTCCTCCACGG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3869R-1.in silico     1   TCTCGATGGTGACCGGGCAAACGGGCCCCGCCGACGACGACCGTCACGCCTCCTCCACGG 60


3869R-1.IR_full       61  ACACGGTGGACAAATCCGGACCCGGTTCCCCGCTATCCCGGTTCAACTCATCGCTGCAAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3869R-1.in silico     61  ACACGGTGGACAAATCCGGACCCGGTTCCCCGCTATCCCGGTTCAACTCATCGCTGCAAC 120


3869R-1.IR_full       121 AATCCGGCTCCACAATGGCCGCCAATCTGCTACCGGAATCGCGGCTCTATCAATCCAACG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3869R-1.in silico     121 AATCCGGCTCCACAATGGCCGCCAATCTGCTACCGGAATCGCGGCTCTATCAATCCAACG 180


3869R-1.IR_full       181 ACAAATCACCGCTCCAGATCTTTGTGCGCGCCAAAAAGAAGATCAACGATATCTACGGCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3869R-1.in silico     181 ACAAATCACCGCTCCAGATCTTTGTGCGCGCCAAAAAGAAGATCAACGATATCTACGGCG 240


3869R-1.IR_full       241 AGATCGAGGAGTATGTCCATGAGACGACCACCTTTATCAACGCCCTGCACGCGGAAGCGG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3869R-1.in silico     241 AGATCGAGGAGTATGTCCATGAGACGACCACCTTTATCAACGCCCTGCACGCGGAAGCGG 300


3869R-1.IR_full       301 AGATCGTGGACAAGGCGGAACGGGAGCTGTTCGAAAGCTATGTGTACAAGGTGGCGGCCA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3869R-1.in silico     301 AGATCGTGGACAAGGCGGAACGGGAGCTGTTCGAAAGCTATGTGTACAAGGTGGCGGCCA 360


3869R-1.IR_full       361 TTCGCGAAGTACTGCAGCGGGATCACATGAAGGTGGCCTTCTTTGGACGCACCTCCAACG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3869R-1.in silico     361 TTCGCGAAGTACTGCAGCGGGATCACATGAAGGTGGCCTTCTTTGGACGCACCTCCAACG 420


3869R-1.IR_full       421 GCAAGAGCTCGGTGATTAATGCCATGTTGCGCGAGAAGATCCTGCCCAGCGGCATTGGGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3869R-1.in silico     421 GCAAGAGCTCGGTGATTAATGCCATGTTGCGCGAGAAGATCCTGCCCAGCGGCATTGGGC 480


3869R-1.IR_full       481 ACACCACGAATTGCTTTCTGC 501
                          |||||||||||||| ||||||
3869R-1.in silico     481 ACACCACGAATTGC-TTCTGC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132092.2  CG3869-RA, transcript variant A (Marf), mRNA 
100   482  NM_206634.1  CG3869-RC, transcript variant C (Marf), mRNA 
100   482  NM_206635.2  CG3869-RB, transcript variant B (Marf), mRNA 
0.2   NM_134830.1  CG3597-RA (CG3597), mRNA 
0   NM_137921.1  CG30188-RA (CG30188), mRNA 
0   NM_206253.1  CG12002-RE, transcript variant E (Pxn), mRNA 
0   NM_206254.1  CG12002-RD, transcript variant D (Pxn), mRNA 
0   NM_206255.1  CG12002-RC, transcript variant C (Pxn), mRNA 
0   NM_079167.3  CG12002-RA, transcript variant A (Pxn), mRNA 
0   NM_167957.1  CG12002-RB, transcript variant B (Pxn), mRNA 
0   14  NM_141666.2  CG9492-RA (CG9492), mRNA 
0   NM_142572.1  CG11659-RA (CG11659), mRNA 
0   NM_142571.1  CG6300-RA (CG6300), mRNA 
0   NM_165003.1  CG31762-RC, transcript variant C (aret), mRNA 
0   NM_165004.1  CG31762-RA, transcript variant A (aret), mRNA 
0   NM_134772.2  CG31937-RA (CG31937), mRNA 
0   NM_143784.2  CG17645-RA (Pglym87), mRNA 
0   NM_140664.2  CG9706-RA, transcript variant A (CG9706), mRNA 
0   NM_168684.1  CG9706-RB, transcript variant B (CG9706), mRNA 
0   NM_206007.1  CG33316-RA, transcript variant A (CG33316), mRNA 
0   NM_206008.1  CG33316-RB, transcript variant B (CG33316), mRNA 
0   NM_135613.1  CG6508-RA (CG6508), mRNA 
0   NM_078609.2  CG11654-RA (Ahcy13), mRNA 
0   NM_137449.2  CG5661-RA (Sema-5c), mRNA 
0   NM_141619.2  CG8444-RA (CG8444), mRNA 
0   20  18  NM_170060.1  CG4568-RA (fzo), mRNA 
0   NM_057678.3  CG31240-RA (repo), mRNA 
0   NM_143459.1  CG1964-RA (Kul), mRNA 
0   NM_140117.1  CG14163-RA (CG14163), mRNA 
0   NM_167150.1  CG2151-RC, transcript variant C (Trxr-1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.