National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3861R-3 
 Symbol kdn  Full Name knockdown 
 CG No CG3861  Old CG No CG3861 
 Synonyms kdn, CG3861, l(1)G0033, l(1)G0159, BEST:GM01832, l(1)G0030 
 Accession No (Link to NCBI) NM_132091.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCAAATGTGGGAGCCTATGTT 
 Primer Seq. 3'
aatctagaggtaccTTGGCGAATTTGCTGTCGTGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCAAATGTGG GAGCCTATNT TCNCANGATC GCCGCCGATG GcAAGAGCCT GCGCGACGTG 
0061 CTGGCCGCCA AGGTGCCCCA GGAGCAGGAG CGCGTAAAGA ACTTCCGCAA GCAGCATGGC 
0121 GCCACCAAGA TGGGCGAGAC GACCATCGAC ATGATGTACG GCGGCATGcN CGGCATCAAG 
0181 GCCCTGGTCA CCGAGACCTC GGTGCTGGAT NCTGACGAGG NTATCNNCTT CNGCggCNTC 
0241 TCCATTCCCG AGTGCCAAAA GGTTCTGCCA GCCGCCGATg gNGGCNCTGA GCCCCTGCCC 
0301 GAGGGTCTCT TCTGGCTGCT GTTGACCGGC GAGGTGCCCA CCAAGTCCCA GGTGCAGCAG 
0361 CTGTCCCGCG AATGGGCCGA GCGCGCCGCC CTGCCCCAGC ACGTGGTCAC CATGTTGAAC 
0421 AACATGCCCA CCACCCTGCA CCCGATGTCG CAGTTTGCTA GCCGCCGTCA CTGCGCTGAA 
0481 TCACGACAGC AAATTCGCCA A 
 in silico PCR Fragment
0001 CCAAATGTGG GAGCCTATGT TCGCATGATC GCCGCCGATG GCAAGAGCCT GCGCGACGTG 
0061 CTGGCCGCCA AGGTGCCCCA GGAGCAGGAG CGCGTAAAGA ACTTCCGCAA GCAGCATGGC 
0121 GCCACCAAGA TGGGCGAGAC GACCATCGAC ATGATGTACG GCGGCATGCG CGGCATCAAG 
0181 GCCCTGGTCA CCGAGACCTC GGTGCTGGAT GCTGACGAGG GTATCCGCTT CCGCGGCCTC 
0241 TCCATTCCCG AGTGCCAAAA GGTTCTGCCA GCCGCCGATG GCGGCACTGA GCCCCTGCCC 
0301 GAGGGTCTCT TCTGGCTGCT GTTGACCGGC GAGGTGCCCA CCAAGTCCCA GGTGCAGCAG 
0361 CTGTCCCGCG AATGGGCCGA GCGCGCCGCC CTGCCCCAGC ACGTGGTCAC CATGTTGAAC 
0421 AACATGCCCA CCACCCTGCA CCCGATGTCG CAGTTTGCT- GCCGCCGTCA CTGCGCTGAA 
0481 TCACGACAGC AAATTCGCCA A 
 Assemble Data

3861R-3.IR_full       1   CCAAATGTGGGAGCCTATNTTCNCANGATCGCCGCCGATGGCAAGAGCCTGCGCGACGTG 60
                          |||||||||||||||||| ||| || ||||||||||||||||||||||||||||||||||
3861R-3.in silico     1   CCAAATGTGGGAGCCTATGTTCGCATGATCGCCGCCGATGGCAAGAGCCTGCGCGACGTG 60


3861R-3.IR_full       61  CTGGCCGCCAAGGTGCCCCAGGAGCAGGAGCGCGTAAAGAACTTCCGCAAGCAGCATGGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3861R-3.in silico     61  CTGGCCGCCAAGGTGCCCCAGGAGCAGGAGCGCGTAAAGAACTTCCGCAAGCAGCATGGC 120


3861R-3.IR_full       121 GCCACCAAGATGGGCGAGACGACCATCGACATGATGTACGGCGGCATGCNCGGCATCAAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
3861R-3.in silico     121 GCCACCAAGATGGGCGAGACGACCATCGACATGATGTACGGCGGCATGCGCGGCATCAAG 180


3861R-3.IR_full       181 GCCCTGGTCACCGAGACCTCGGTGCTGGATNCTGACGAGGNTATCNNCTTCNGCGGCNTC 240
                          |||||||||||||||||||||||||||||| ||||||||| ||||  |||| ||||| ||
3861R-3.in silico     181 GCCCTGGTCACCGAGACCTCGGTGCTGGATGCTGACGAGGGTATCCGCTTCCGCGGCCTC 240


3861R-3.IR_full       241 TCCATTCCCGAGTGCCAAAAGGTTCTGCCAGCCGCCGATGGNGGCNCTGAGCCCCTGCCC 300
                          ||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||
3861R-3.in silico     241 TCCATTCCCGAGTGCCAAAAGGTTCTGCCAGCCGCCGATGGCGGCACTGAGCCCCTGCCC 300


3861R-3.IR_full       301 GAGGGTCTCTTCTGGCTGCTGTTGACCGGCGAGGTGCCCACCAAGTCCCAGGTGCAGCAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3861R-3.in silico     301 GAGGGTCTCTTCTGGCTGCTGTTGACCGGCGAGGTGCCCACCAAGTCCCAGGTGCAGCAG 360


3861R-3.IR_full       361 CTGTCCCGCGAATGGGCCGAGCGCGCCGCCCTGCCCCAGCACGTGGTCACCATGTTGAAC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3861R-3.in silico     361 CTGTCCCGCGAATGGGCCGAGCGCGCCGCCCTGCCCCAGCACGTGGTCACCATGTTGAAC 420


3861R-3.IR_full       421 AACATGCCCACCACCCTGCACCCGATGTCGCAGTTTGCTAGCCGCCGTCACTGCGCTGAA 480
                          ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
3861R-3.in silico     421 AACATGCCCACCACCCTGCACCCGATGTCGCAGTTTGCT-GCCGCCGTCACTGCGCTGAA 480


3861R-3.IR_full       481 TCACGACAGCAAATTCGCCAA 501
                          |||||||||||||||||||||
3861R-3.in silico     481 TCACGACAGCAAATTCGCCAA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_167072.1  CG3861-RB, transcript variant B (l(1)G0030), mRNA 
100   482  NM_132091.2  CG3861-RA, transcript variant A (l(1)G0030), mRNA 
0   NM_132661.1  CG12726-RA (CG12726), mRNA 
0   NM_137096.2  CG8468-RB, transcript variant B (CG8468), mRNA 
0   NM_166039.1  CG8468-RC, transcript variant C (CG8468), mRNA 
0   NM_166038.1  CG8468-RA, transcript variant A (CG8468), mRNA 
0   NM_168179.1  CG32394-RA (CG32394), mRNA 
0   NM_135741.2  CG5776-RA (CG5776), mRNA 
0   NM_206045.1  CG3572-RC, transcript variant C (vimar), mRNA 
0   NM_057957.4  CG3572-RB, transcript variant B (vimar), mRNA 
0   NM_057988.3  CG6620-RA (ial), mRNA 
0   NM_001043131.1  CG33274-RB (CG33274), mRNA 
0   NM_141708.2  CG12807-RA (CG12807), mRNA 
0   NM_057598.3  CG10739-RA (pigeon), mRNA 
0   NM_140933.1  CG7017-RA (CG7017), mRNA 
0   NM_080155.2  CG18627-RA (betaggt-II), mRNA 
0   NM_001032236.1  CG8529-RE, transcript variant E (Dyb), mRNA 
0   NM_165905.2  CG8529-RC, transcript variant C (Dyb), mRNA 
0   NM_165904.1  CG8529-RA, transcript variant A (Dyb), mRNA 
0   NM_001032237.1  CG8529-RD, transcript variant D (Dyb), mRNA 
0   NM_078988.2  CG8529-RB, transcript variant B (Dyb), mRNA 
0   NM_169560.1  CG2988-RA (ems), mRNA 
0   NM_169234.1  CG9786-RB, transcript variant B (hb), mRNA 
0   NM_176679.2  CG4122-RC, transcript variant C (svr), mRNA 
0   NM_206596.1  CG4122-RG, transcript variant G (svr), mRNA 
0   NM_080293.3  CG4122-RB, transcript variant B (svr), mRNA 
0   NM_206599.1  CG4122-RD, transcript variant D (svr), mRNA 
0   NM_166846.3  CG4122-RA, transcript variant A (svr), mRNA 
0   NM_206598.2  CG4122-RE, transcript variant E (svr), mRNA 
0   NM_206597.1  CG4122-RF, transcript variant F (svr), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.