National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3861R-2 
 Symbol kdn  Full Name knockdown 
 CG No CG3861  Old CG No CG3861 
 Synonyms kdn, CG3861, l(1)G0033, l(1)G0159, BEST:GM01832, l(1)G0030 
 Accession No (Link to NCBI) NM_132091.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||| ||| || |||||||||||||||||||||||||||||||||| silico     1   CCAAATGTGGGAGCCTATGTTCGCATGATCGCCGCCGATGGCAAGAGCCTGCGCGACGTG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CTGGCCGCCAAGGTGCCCCAGGAGCAGGAGCGCGTAAAGAACTTCCGCAAGCAGCATGGC 120

                          ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| silico     121 GCCACCAAGATGGGCGAGACGACCATCGACATGATGTACGGCGGCATGCGCGGCATCAAG 180

                          |||||||||||||||||||||||||||||| ||||||||| ||||  |||| ||||| || silico     181 GCCCTGGTCACCGAGACCTCGGTGCTGGATGCTGACGAGGGTATCCGCTTCCGCGGCCTC 240

                          ||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| silico     241 TCCATTCCCGAGTGCCAAAAGGTTCTGCCAGCCGCCGATGGCGGCACTGAGCCCCTGCCC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GAGGGTCTCTTCTGGCTGCTGTTGACCGGCGAGGTGCCCACCAAGTCCCAGGTGCAGCAG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CTGTCCCGCGAATGGGCCGAGCGCGCCGCCCTGCCCCAGCACGTGGTCACCATGTTGAAC 420

                          ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| silico     421 AACATGCCCACCACCCTGCACCCGATGTCGCAGTTTGCT-GCCGCCGTCACTGCGCTGAA 480

3861R-2.IR_full       481 TCACGACAGCAAATTCGCCAA 501
                          ||||||||||||||||||||| silico     481 TCACGACAGCAAATTCGCCAA 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_167072.1  CG3861-RB, transcript variant B (l(1)G0030), mRNA 
100   482  NM_132091.2  CG3861-RA, transcript variant A (l(1)G0030), mRNA 
0   NM_132661.1  CG12726-RA (CG12726), mRNA 
0   NM_137096.2  CG8468-RB, transcript variant B (CG8468), mRNA 
0   NM_166039.1  CG8468-RC, transcript variant C (CG8468), mRNA 
0   NM_166038.1  CG8468-RA, transcript variant A (CG8468), mRNA 
0   NM_168179.1  CG32394-RA (CG32394), mRNA 
0   NM_135741.2  CG5776-RA (CG5776), mRNA 
0   NM_206045.1  CG3572-RC, transcript variant C (vimar), mRNA 
0   NM_057957.4  CG3572-RB, transcript variant B (vimar), mRNA 
0   NM_057988.3  CG6620-RA (ial), mRNA 
0   NM_001043131.1  CG33274-RB (CG33274), mRNA 
0   NM_141708.2  CG12807-RA (CG12807), mRNA 
0   NM_057598.3  CG10739-RA (pigeon), mRNA 
0   NM_140933.1  CG7017-RA (CG7017), mRNA 
0   NM_080155.2  CG18627-RA (betaggt-II), mRNA 
0   NM_001032236.1  CG8529-RE, transcript variant E (Dyb), mRNA 
0   NM_165905.2  CG8529-RC, transcript variant C (Dyb), mRNA 
0   NM_165904.1  CG8529-RA, transcript variant A (Dyb), mRNA 
0   NM_001032237.1  CG8529-RD, transcript variant D (Dyb), mRNA 
0   NM_078988.2  CG8529-RB, transcript variant B (Dyb), mRNA 
0   NM_169560.1  CG2988-RA (ems), mRNA 
0   NM_169234.1  CG9786-RB, transcript variant B (hb), mRNA 
0   NM_176679.2  CG4122-RC, transcript variant C (svr), mRNA 
0   NM_206596.1  CG4122-RG, transcript variant G (svr), mRNA 
0   NM_080293.3  CG4122-RB, transcript variant B (svr), mRNA 
0   NM_206599.1  CG4122-RD, transcript variant D (svr), mRNA 
0   NM_166846.3  CG4122-RA, transcript variant A (svr), mRNA 
0   NM_206598.2  CG4122-RE, transcript variant E (svr), mRNA 
0   NM_206597.1  CG4122-RF, transcript variant F (svr), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.