National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3835R-3 
 Symbol CG3835  Full Name CG3835 
 CG No CG3835  Old CG No CG3835 
 Synonyms EG87B1, EG:87B1.3, CG3835 
 Accession No (Link to NCBI) NM_130626.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment balanced with Green Balancer. CyO, P{w[+mC]=ActGFP}JMR1 
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCACCACCACCACCATCACCAC 
 Primer Seq. 3'
aatctagaggtaccCGAAGTTCTCCAGGATGCAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CACCACCACC ACCATCACCA CCACCAGTCG CACCGCCCTG GCAGCCACCT ACCCCGCTTT 
0061 CGCAACCACT GTGCGCACAA TGGCGGGCAG CGGGGCTCCG ATCCCGGAGC TCACAGAGAT 
0121 CACCGACAAC GTGCAGCGCG GCAACTACGC CACTCTGACC GACAAGGATG TGGCGCATTT 
0181 CGAGCAGCTC CTGGGCAAGA NACTTCGTGC TCACTGAGGA CCTGGAGGGA TACAACATCT 
0241 GCTTCCTTAA GAGGATTCGA GGCAACAGCA AGTTGGTGCT TAAGCCCGGA ANGCACGGCG 
0301 GAGGTGGCCG CCATCCTGAA GTACTGCAAC GAGCGTCGTT TGGCGGTGGN TGccGCAGGG 
0361 CGGGANACAC AGGTCTAGTG GGCGGATCCG TGCCGATCTG CGACGAGATT GTCCTTTCTC 
0421 TAGCGCGCCT GAACAAGGTG TTATCCGTGG ACGAGGTCAC CGGCATTGCT GTCGTGGAGG 
0481 CGGGCTGCAT CCTGGAGAAC TTCG 
 in silico PCR Fragment
0001 CACCACCACC ACCATCACCA CCACCAGTCG CACCGCCCTG GCAGCCACCT ACCCCGCTTT 
0061 CGCAACCACT GTGCGCACAA TGGCGGGCAG CGGGGCTCCG ATCCCGGAGC TCACAGAGAT 
0121 CACCGACAAC GTGCAGCGCG GCAACTACGC CACTCTGACC GACAAGGATG TGGCGCATTT 
0181 CGAGCAGCTC CTGGGCAAGA -ACTTCGTGC TCACTGAGGA CCTGGAGGGA TACAACATCT 
0241 GCTTCCTTAA GAGGATTCGA GGCAACAGCA AGTTGGTGCT TAAGCCCGGA A-GCACGGCG 
0301 GAGGTGGCCG CCATCCTGAA GTACTGCAAC GAGCGTCGTT TGGCGGTGG- TGCCGCAGGG 
0361 CGGGA-ACAC AGGTCTAGTG GGCGGATCCG TGCCGATCTG CGACGAGATT GTCCTTTCTC 
0421 TAGCGCGCCT GAACAAGGTG TTATCCGTGG ACGAGGTCAC CGGCATTGCT GTCGTGGAGG 
0481 CGGGCTGCAT CCTGGAGAAC TTCG 
 Assemble Data

3835R-3.IR_full       1   CACCACCACCACCATCACCACCACCAGTCGCACCGCCCTGGCAGCCACCTACCCCGCTTT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3835R-3.in silico     1   CACCACCACCACCATCACCACCACCAGTCGCACCGCCCTGGCAGCCACCTACCCCGCTTT 60


3835R-3.IR_full       61  CGCAACCACTGTGCGCACAATGGCGGGCAGCGGGGCTCCGATCCCGGAGCTCACAGAGAT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3835R-3.in silico     61  CGCAACCACTGTGCGCACAATGGCGGGCAGCGGGGCTCCGATCCCGGAGCTCACAGAGAT 120


3835R-3.IR_full       121 CACCGACAACGTGCAGCGCGGCAACTACGCCACTCTGACCGACAAGGATGTGGCGCATTT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3835R-3.in silico     121 CACCGACAACGTGCAGCGCGGCAACTACGCCACTCTGACCGACAAGGATGTGGCGCATTT 180


3835R-3.IR_full       181 CGAGCAGCTCCTGGGCAAGANACTTCGTGCTCACTGAGGACCTGGAGGGATACAACATCT 240
                          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
3835R-3.in silico     181 CGAGCAGCTCCTGGGCAAGA-ACTTCGTGCTCACTGAGGACCTGGAGGGATACAACATCT 240


3835R-3.IR_full       241 GCTTCCTTAAGAGGATTCGAGGCAACAGCAAGTTGGTGCTTAAGCCCGGAANGCACGGCG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
3835R-3.in silico     241 GCTTCCTTAAGAGGATTCGAGGCAACAGCAAGTTGGTGCTTAAGCCCGGAA-GCACGGCG 300


3835R-3.IR_full       301 GAGGTGGCCGCCATCCTGAAGTACTGCAACGAGCGTCGTTTGGCGGTGGNTGCCGCAGGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
3835R-3.in silico     301 GAGGTGGCCGCCATCCTGAAGTACTGCAACGAGCGTCGTTTGGCGGTGG-TGCCGCAGGG 360


3835R-3.IR_full       361 CGGGANACACAGGTCTAGTGGGCGGATCCGTGCCGATCTGCGACGAGATTGTCCTTTCTC 420
                          ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
3835R-3.in silico     361 CGGGA-ACACAGGTCTAGTGGGCGGATCCGTGCCGATCTGCGACGAGATTGTCCTTTCTC 420


3835R-3.IR_full       421 TAGCGCGCCTGAACAAGGTGTTATCCGTGGACGAGGTCACCGGCATTGCTGTCGTGGAGG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3835R-3.in silico     421 TAGCGCGCCTGAACAAGGTGTTATCCGTGGACGAGGTCACCGGCATTGCTGTCGTGGAGG 480


3835R-3.IR_full       481 CGGGCTGCATCCTGGAGAACTTCG 504
                          ||||||||||||||||||||||||
3835R-3.in silico     481 CGGGCTGCATCCTGGAGAACTTCG 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  14  11  NM_166929.1  CG3835-RB, transcript variant B (CG3835), mRNA 
100   482  14  11  NM_166930.1  CG3835-RC, transcript variant C (CG3835), mRNA 
100   482  14  11  NM_130626.2  CG3835-RA, transcript variant A (CG3835), mRNA 
1.65   43  41  NM_136646.1  CG13953-RA (CG13953), mRNA 
1.03   10  23  29  NM_136533.1  CG11641-RA (pdm3), mRNA 
1.03   10  14  NM_001031953.1  CG6128-RA, transcript variant A (CG6128), mRNA 
1.03   10  14  NM_001031952.1  CG11714-RA, transcript variant A (CG11714), mRNA 
1.03   37  15  NM_166621.1  CG4091-RA, transcript variant A (CG4091), mRNA 
1.03   37  15  NM_166622.1  CG4091-RC, transcript variant C (CG4091), mRNA 
1.03   37  15  NM_137976.2  CG4091-RB, transcript variant B (CG4091), mRNA 
0.82   19  34  NM_078726.2  CG4385-RB, transcript variant B (S), mRNA 
0.82   19  34  NM_164403.1  CG4385-RA, transcript variant A (S), mRNA 
0.82   19  29  NM_079322.2  CG10605-RA (caup), mRNA 
0.82   10  NM_130617.2  CG4281-RA (CG4281), mRNA 
0.62   26  NM_165585.1  CG12769-RB, transcript variant B (CG12769), mRNA 
0.62   26  NM_136503.2  CG12769-RA, transcript variant A (CG12769), mRNA 
0.62   28  NM_079109.2  CG5575-RA (ken), mRNA 
0.62   11  27  NM_168240.1  CG32365-RA (CG32365), mRNA 
0.62   NM_165813.1  CG30027-RA (CG30027), mRNA 
0.62   17  16  NM_141046.3  CG7605-RA (Rab26), mRNA 
0.41   12  27  NM_166164.2  CG8048-RD, transcript variant D (Vha44), mRNA 
0.41   12  27  NM_166163.1  CG8048-RC, transcript variant C (Vha44), mRNA 
0.41   22  NM_169403.1  CG6791-RA, transcript variant A (CG6791), mRNA 
0.41   22  NM_141833.2  CG6791-RB, transcript variant B (CG6791), mRNA 
0.41   26  41  NM_132704.1  CG11071-RA (CG11071), mRNA 
0.41   16  13  NM_143196.1  CG8968-RA (CG8968), mRNA 
0.41   12  NM_166146.1  CG8428-RB, transcript variant B (spin), mRNA 
0.41   12  NM_166144.1  CG8428-RC, transcript variant C (spin), mRNA 
0.41   12  NM_080084.2  CG8428-RD, transcript variant D (spin), mRNA 
0.41   12  NM_166145.1  CG8428-RA, transcript variant A (spin), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.