National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3803R-2 
 Symbol CG3803  Full Name CG3803 
 CG No CG3803  Old CG No CG3803 
 Synonyms CG3803 
 Accession No (Link to NCBI) NM_138011.2 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CATCAGCACTCCGAAAAGCGACAAGACCGTCGGAAGATGGTTCCTGGGAGTCAGCGGCAT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GGTCTTCGTGGCCGTTGGTCTAGGCGGAGTAACCCGACTGACAGAGTCCGGACTGTCCAT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GGTCACTTGGAAGCTGACGGGTGAACGTATGCCCCGAACCCAGGAGGAATGGGTGCAGGA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GTTCAATCTCTACCAGCAATACCCAGAGTACAAGCTAAAGAATGTGAATATGACCGTGGA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GGAGTTCAAGTTCATTTTCATGATGGAGTACATGCACAGGATGTGGGGTCGTGCCATCGG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGGGTTCTTCCTTTTGCCCGCTGTTTACTTCTGGAGAAAGGGATACTTCTGTGCGAAGAC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CAAGAAGAGCGTCCTGCTGCTGGGCACACTGATTGGCCTGCAAGGTCTGATGGGATGGTA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CATGGTCAAGTCCGGGCTGGAAGACAGGTTCCAGGATCCCAACGACGTGCCACGGGTATC 480

3803R-2.IR_full       481 CCAGTATAGATTGGCCTCCC 500
                          |||||||||||||||||||| silico     481 CCAGTATAGATTGGCCTCCC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_138011.2  CG3803-RA (CG3803), mRNA 
0.2   NM_136875.2  CG17509-RA (CG17509), mRNA 
0   NM_206278.1  CG5406-RC, transcript variant C (sif), mRNA 
0   NM_079908.2  CG5406-RA, transcript variant A (sif), mRNA 
0   NM_057983.2  CG8823-RA (Lip3), mRNA 
0   NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_001032052.1  CG33715-RE, transcript variant E (Msp-300), mRNA 
0   NM_176579.1  CG33203-RC (CG33203), mRNA 
0   NM_080102.3  CG10506-RA (Aats-gln), mRNA 
0   NM_143665.2  CG2041-RA (lgs), mRNA 
0   NM_176570.1  CG33083-RA (Gr97a), mRNA 
0   NM_176694.1  CG3126-RB, transcript variant B (C3G), mRNA 
0   NM_132122.2  CG3126-RA, transcript variant A (C3G), mRNA 
0   NM_134961.1  CG10019-RA (CG10019), mRNA 
0   NM_078690.2  CG12530-RA, transcript variant A (Cdc42), mRNA 
0   NM_167677.1  CG12530-RB, transcript variant B (Cdc42), mRNA 
0   NM_001038969.1  CG12753-RB, transcript variant B (CG12753), mRNA 
0   NM_142285.1  CG12753-RA, transcript variant A (CG12753), mRNA 
0   NM_134281.1  CG8651-RC, transcript variant C (trx), mRNA 
0   NM_057421.2  CG8651-RD, transcript variant D (trx), mRNA 
0   NM_057422.2  CG8651-RB, transcript variant B (trx), mRNA 
0   NM_001014621.1  CG8651-RE, transcript variant E (trx), mRNA 
0   NM_134282.1  CG8651-RA, transcript variant A (trx), mRNA 
0   NM_142784.2  CG13852-RA (mats), mRNA 
0   NM_137971.2  CG5428-RA (CG5428), mRNA 
0   NM_142267.2  CG5916-RA (CG5916), mRNA 
0   NM_133148.2  CG8034-RA (CG8034), mRNA 
0   12  NM_078670.2  CG7092-RA (Dhc16F), mRNA 
0   NM_168171.1  CG32397-RA (CG32397), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.