National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3801R-1 
 Symbol Acp76A  Full Name Accessory gland-specific peptide 76A 
 CG No CG3801  Old CG No CG3801 
 Synonyms CG3801, Acp76, Acp76A 
 Accession No (Link to NCBI) NM_079429.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGCACGTCGCTCCTCTTTCAA 
 Primer Seq. 3'
aatctagaggtaccACTGTCATTCCGCTGATGGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGCACGTCGC TCCTCTTTCA AAATACAATA CAACAAAATG TATCATTTCA ACTGATAAGG 
0061 GAAATCGATA GATACACACC AGAGAATTTT GTACTATCAG TGTTGAATAT AGAAATGATT 
0121 CTTTTTGAGA TCCATGCCGC TAAGGCAGNT TGAAAGTAAT AACGATTTGG AAAGGAGCTT 
0181 GATCATAAAC TTTGGATACT CCGAAGCAAG GCAGGAAGTA CTGGATTGGG GATTGAGATA 
0241 TAAGAAAGCC TCGAGCGCCA AGTTCCAGAT GGCCAACAAG GTGGCAGTGT CTCAGAAACT 
0301 GCCCCTATCG CAAAAGCTGC GTCTGGTAAA CGAGGTGCTG ATGACGAGCG CCAAGAAGTA 
0361 TGATGTAACA AAGGATGTCA GACCATCAAA ATTAATGGAT GAATGGTTGT CCTCCCATTT 
0421 GGATGGTGTA CTCGCCAATT TTGTACAAGA GAAGAAGTTA AACGCGGGCG AAAACATTGT 
0481 AGCCATCAGC GGAATGACAG T 
 in silico PCR Fragment
0001 TGCACGTCGC TCCTCTTTCA AAATACAATA CAACAAAATG TATCATTTCA ACTGATAAGG 
0061 GAAATCGATA GATACACACC AGAGAATTTT GTACTATCAG TGTTGAATAT AGAAATGATT 
0121 CTTTTTGAGA TCCATGCCGC TAAGGCAG-T TGAAAGTAAT AACGATTTGG AAAGGAGCTT 
0181 GATCATAAAC TTTGGATACT CCGAAGCAAG GCAGGAAGTA CTGGATTGGG GATTGAGATA 
0241 TAAGAAAGCC TCGAGCGCCA AGTTCCAGAT GGCCAACAAG GTGGCAGTGT CTCAGAAACT 
0301 GCCCCTATCG CAAAAGCTGC GTCTGGTAAA CGAGGTGCTG ATGACGAGCG CCAAGAAGTA 
0361 TGATGTAACA AAGGATGTCA GACCATCAAA ATTAATGGAT GAATGGTTGT CCTCCCATTT 
0421 GGATGGTGTA CTCGCCAATT TTGTACAAGA GAAGAAGTTA AACGCGGGCG AAAACATTGT 
0481 AGCCATCAGC GGAATGACAG T 
 Assemble Data

3801R-1.IR_full       1   TGCACGTCGCTCCTCTTTCAAAATACAATACAACAAAATGTATCATTTCAACTGATAAGG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3801R-1.in silico     1   TGCACGTCGCTCCTCTTTCAAAATACAATACAACAAAATGTATCATTTCAACTGATAAGG 60


3801R-1.IR_full       61  GAAATCGATAGATACACACCAGAGAATTTTGTACTATCAGTGTTGAATATAGAAATGATT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3801R-1.in silico     61  GAAATCGATAGATACACACCAGAGAATTTTGTACTATCAGTGTTGAATATAGAAATGATT 120


3801R-1.IR_full       121 CTTTTTGAGATCCATGCCGCTAAGGCAGNTTGAAAGTAATAACGATTTGGAAAGGAGCTT 180
                          |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
3801R-1.in silico     121 CTTTTTGAGATCCATGCCGCTAAGGCAG-TTGAAAGTAATAACGATTTGGAAAGGAGCTT 180


3801R-1.IR_full       181 GATCATAAACTTTGGATACTCCGAAGCAAGGCAGGAAGTACTGGATTGGGGATTGAGATA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3801R-1.in silico     181 GATCATAAACTTTGGATACTCCGAAGCAAGGCAGGAAGTACTGGATTGGGGATTGAGATA 240


3801R-1.IR_full       241 TAAGAAAGCCTCGAGCGCCAAGTTCCAGATGGCCAACAAGGTGGCAGTGTCTCAGAAACT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3801R-1.in silico     241 TAAGAAAGCCTCGAGCGCCAAGTTCCAGATGGCCAACAAGGTGGCAGTGTCTCAGAAACT 300


3801R-1.IR_full       301 GCCCCTATCGCAAAAGCTGCGTCTGGTAAACGAGGTGCTGATGACGAGCGCCAAGAAGTA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3801R-1.in silico     301 GCCCCTATCGCAAAAGCTGCGTCTGGTAAACGAGGTGCTGATGACGAGCGCCAAGAAGTA 360


3801R-1.IR_full       361 TGATGTAACAAAGGATGTCAGACCATCAAAATTAATGGATGAATGGTTGTCCTCCCATTT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3801R-1.in silico     361 TGATGTAACAAAGGATGTCAGACCATCAAAATTAATGGATGAATGGTTGTCCTCCCATTT 420


3801R-1.IR_full       421 GGATGGTGTACTCGCCAATTTTGTACAAGAGAAGAAGTTAAACGCGGGCGAAAACATTGT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3801R-1.in silico     421 GGATGGTGTACTCGCCAATTTTGTACAAGAGAAGAAGTTAAACGCGGGCGAAAACATTGT 480


3801R-1.IR_full       481 AGCCATCAGCGGAATGACAGT 501
                          |||||||||||||||||||||
3801R-1.in silico     481 AGCCATCAGCGGAATGACAGT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079429.1  CG3801-RA (Acp76A), mRNA 
0.82   NM_176776.2  CG14617-RB, transcript variant B (CG14617), mRNA 
0.82   NM_001038768.1  CG14617-RD, transcript variant D (CG14617), mRNA 
0.82   NM_001038770.1  CG14617-RE, transcript variant E (CG14617), mRNA 
0.82   NM_176775.1  CG14617-RA, transcript variant A (CG14617), mRNA 
0.82   NM_001038769.1  CG14617-RC, transcript variant C (CG14617), mRNA 
0   NM_079677.2  CG6027-RA (cdi), mRNA 
0   NM_132788.2  CG9114-RA (CG9114), mRNA 
0   NM_078607.2  CG6157-RA (dah), mRNA 
0   NM_139873.2  CG8539-RA (CG8539), mRNA 
0   NM_078800.2  CG4422-RA (Gdi), mRNA 
0   NM_170562.1  CG1815-RA, transcript variant A (CG1815), mRNA 
0   NM_143624.2  CG1815-RC, transcript variant C (CG1815), mRNA 
0   NM_170563.1  CG1815-RB, transcript variant B (CG1815), mRNA 
0   NM_057976.2  CG1897-RA (Dr), mRNA 
0   NM_001042834.1  CG41475-RA (CG41475), mRNA 
0   NM_139848.2  CG8600-RA (CG8600), mRNA 
0   NM_169370.2  CG6584-RB, transcript variant B (SelR), mRNA 
0   NM_141773.2  CG6584-RA, transcript variant A (SelR), mRNA 
0   NM_206473.1  CG6584-RF, transcript variant F (SelR), mRNA 
0   NM_169371.1  CG6584-RD, transcript variant D (SelR), mRNA 
0   NM_142318.4  CG31275-RB, transcript variant B (CG31275), mRNA 
0   NM_078664.2  CG5870-RA (beta-Spec), mRNA 
0   NM_132959.2  CG8949-RA (CG8949), mRNA 
0   NM_141611.1  CG9746-RA (CG9746), mRNA 
0   NM_168361.1  CG16711-RB, transcript variant B (CG16711), mRNA 
0   NM_136704.2  CG2264-RB, transcript variant B (CG2264), mRNA 
0   NM_138050.2  CG3363-RA (CG3363), mRNA 
0   NM_165733.1  CG2264-RE, transcript variant E (CG2264), mRNA 
0   NM_165732.1  CG2264-RD, transcript variant D (CG2264), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.