National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3793R-3 
 Symbol CG3793  Full Name CG3793 
 CG No CG3793  Old CG No CG3793 
 Synonyms BG:DS09217.4, CG3793 
 Accession No (Link to NCBI) NM_135922.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CCACGGATCTGCATGGACCAAGCTACCACCTGATGGGCGTTGACCTGCGCAACCTCGACG 60

                          ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| silico     61  AGGTGGACAGC-AAGCTGCAGCAGGCAGAAGTTGATTACTCCCTGCCCACCATATTTCTC 120

                          ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| silico     121 GCCGAGTGCGTTCTGGTCTATATCGAGGCGC-AAAACTGCCGTAACCTGCTCAAATGGAT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TGCGCAAAAGTTCCAAGCAGCCGTCTTTGTCAACTACGAACAGGTCAACATGAACGACCG 240

                          |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| silico     241 TTTCGGCGATGTGATGCTCAACAATCTGCGCGGACGCGGCTGCAGCCTGGCCGGCGTTGA 300

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| silico     301 ATCCTGCTTGTCGCTGGATACGCAGAGGAACCGCTTCAAGGACAGCGGCTGGA-CTGGCG 360

                          |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CCCGCGCCTG-GGACATGGTCCAGGTGTACGAGAGCATCTCGGCGGCCGAGAGGCAGCG- 420

                          |||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| silico     421 AATCGAGCGGCTGGAAATGCTGGACGAGGGTGAACTGCTGCTCCAGCTTTTCCAGCACTA 480

3793R-3.IR_full       481 CTGCCTGGTGGTCGCCNGNACTCT 504
                          |||||||||||||||       || silico     481 CTGCCTGGTGGTCGC-------CT 504

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   474  NM_135922.2  CG3793-RA (CG3793), mRNA 
0.63   NM_137056.2  CG13340-RA (CG13340), mRNA 
0.63   NM_140137.2  CG32063-RA, transcript variant A (CG32063), mRNA 
0.63   NM_168410.1  CG32063-RB, transcript variant B (CG32063), mRNA 
0.42   NM_079520.3  CG15581-RA (Or83c), mRNA 
0   NM_079143.2  CG3340-RA (Kr), mRNA 
0   NM_139954.1  CG7083-RA (CG7083), mRNA 
0   NM_142296.2  CG14899-RA (CG14899), mRNA 
0   NM_136608.2  CG8777-RA (CG8777), mRNA 
0   10  NM_139732.2  CG10542-RA (CG10542), mRNA 
0   NM_142674.2  CG10827-RA (CG10827), mRNA 
0   NM_140463.3  CG9384-RA (CG9384), mRNA 
0   NM_143302.1  CG14264-RA (CG14264), mRNA 
0   NM_001042872.1  CG14042-RB, transcript variant B (CG14042), mRNA 
0   NM_001042871.1  CG14042-RA, transcript variant A (CG14042), mRNA 
0   NM_144359.2  CG14041-RB, transcript variant B (SP555), mRNA 
0   NM_164618.1  CG14041-RA, transcript variant A (SP555), mRNA 
0   NM_170365.1  CG14066-RC, transcript variant C (larp), mRNA 
0   NM_170366.1  CG14066-RB, transcript variant B (larp), mRNA 
0   NM_080259.1  CG14066-RA, transcript variant A (larp), mRNA 
0   NM_132858.2  CG9056-RA (CG9056), mRNA 
0   NM_140289.2  CG17153-RA (CG17153), mRNA 
0   NM_142822.1  CG4917-RA, transcript variant A (wfs1), mRNA 
0   NM_170035.1  CG4917-RB, transcript variant B (wfs1), mRNA 
0   NM_206513.1  CG14307-RL, transcript variant L (fru), mRNA 
0   NM_079827.2  CG7788-RA (Ice), mRNA 
0   NM_057843.2  CG14029-RA, transcript variant A (vri), mRNA 
0   NM_164639.1  CG14029-RC, transcript variant C (vri), mRNA 
0   NM_166563.1  CG30274-RA (CG30274), mRNA 
0   NM_143452.1  CG1911-RA (CAP-D2), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.