National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3793R-2 
 Symbol CG3793  Full Name CG3793 
 CG No CG3793  Old CG No CG3793 
 Synonyms BG:DS09217.4, CG3793 
 Accession No (Link to NCBI) NM_135922.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCACGGATCTGCATGGACCAA 
 Primer Seq. 3'
aatctagaggtaccAGGCGACCACCAGGCAGTAGT 
 Predicted Fragment Size
492 
 IR fragment full Seq
0001 CCACGGATCT GCATGGACCA AGCTACCACC TGATGGGCGT TGACCTGCGC AACCTCGACG 
0061 AGGTGGACAG CAAAGCTGCA GCAGGCAGAA GTTGATTACT CCCTGCCCAC CATATTCCTC 
0121 GCCGAGTGCG TTCTGGTCTA TATCGAGGCG CAAAAACTGC CGTAACCTGC TCAAATGGAT 
0181 TGCGCAAAAG TTCCAAGCAG CCGTCTTTGT CAACTACGAA CAGGTCAACA TGAACGACCG 
0241 TTTCGGCGAT GTGATGCTCA ACAATCTGCG CGGACGTGGC TGCAgCCTGG CCGGCGTTGA 
0301 ATCCTGCTTG TCGCTGGATA CGCAGAGGAA CCGCTTCAAG GACAGCGGCT GGANCTGGCG 
0361 CCCGCGCCTG NGGACATGGT CCAGGTGTAC GAGAGCATCT CGGCGGCCGA GAGGCAGCGA 
0421 AATCGAGCGG CTGGAAATGC TGGACGAGGG TGAACTGCTG CTTCAGCTCT TCCAGCACTA 
0481 CTGCCTGGTG GTCGCCNGNA CTCT 
 in silico PCR Fragment
0001 CCACGGATCT GCATGGACCA AGCTACCACC TGATGGGCGT TGACCTGCGC AACCTCGACG 
0061 AGGTGGACAG C-AAGCTGCA GCAGGCAGAA GTTGATTACT CCCTGCCCAC CATATTTCTC 
0121 GCCGAGTGCG TTCTGGTCTA TATCGAGGCG C-AAAACTGC CGTAACCTGC TCAAATGGAT 
0181 TGCGCAAAAG TTCCAAGCAG CCGTCTTTGT CAACTACGAA CAGGTCAACA TGAACGACCG 
0241 TTTCGGCGAT GTGATGCTCA ACAATCTGCG CGGACGCGGC TGCAGCCTGG CCGGCGTTGA 
0301 ATCCTGCTTG TCGCTGGATA CGCAGAGGAA CCGCTTCAAG GACAGCGGCT GGA-CTGGCG 
0361 CCCGCGCCTG -GGACATGGT CCAGGTGTAC GAGAGCATCT CGGCGGCCGA GAGGCAGCG- 
0421 AATCGAGCGG CTGGAAATGC TGGACGAGGG TGAACTGCTG CTCCAGCTTT TCCAGCACTA 
0481 CTGCCTGGTG GTCGC----- --CT 
 Assemble Data

3793R-2.IR_full       1   CCACGGATCTGCATGGACCAAGCTACCACCTGATGGGCGTTGACCTGCGCAACCTCGACG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3793R-2.in silico     1   CCACGGATCTGCATGGACCAAGCTACCACCTGATGGGCGTTGACCTGCGCAACCTCGACG 60


3793R-2.IR_full       61  AGGTGGACAGCAAAGCTGCAGCAGGCAGAAGTTGATTACTCCCTGCCCACCATATTCCTC 120
                          ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||
3793R-2.in silico     61  AGGTGGACAGC-AAGCTGCAGCAGGCAGAAGTTGATTACTCCCTGCCCACCATATTTCTC 120


3793R-2.IR_full       121 GCCGAGTGCGTTCTGGTCTATATCGAGGCGCAAAAACTGCCGTAACCTGCTCAAATGGAT 180
                          ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
3793R-2.in silico     121 GCCGAGTGCGTTCTGGTCTATATCGAGGCGC-AAAACTGCCGTAACCTGCTCAAATGGAT 180


3793R-2.IR_full       181 TGCGCAAAAGTTCCAAGCAGCCGTCTTTGTCAACTACGAACAGGTCAACATGAACGACCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3793R-2.in silico     181 TGCGCAAAAGTTCCAAGCAGCCGTCTTTGTCAACTACGAACAGGTCAACATGAACGACCG 240


3793R-2.IR_full       241 TTTCGGCGATGTGATGCTCAACAATCTGCGCGGACGTGGCTGCAGCCTGGCCGGCGTTGA 300
                          |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
3793R-2.in silico     241 TTTCGGCGATGTGATGCTCAACAATCTGCGCGGACGCGGCTGCAGCCTGGCCGGCGTTGA 300


3793R-2.IR_full       301 ATCCTGCTTGTCGCTGGATACGCAGAGGAACCGCTTCAAGGACAGCGGCTGGANCTGGCG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
3793R-2.in silico     301 ATCCTGCTTGTCGCTGGATACGCAGAGGAACCGCTTCAAGGACAGCGGCTGGA-CTGGCG 360


3793R-2.IR_full       361 CCCGCGCCTGNGGACATGGTCCAGGTGTACGAGAGCATCTCGGCGGCCGAGAGGCAGCGA 420
                          |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| 
3793R-2.in silico     361 CCCGCGCCTG-GGACATGGTCCAGGTGTACGAGAGCATCTCGGCGGCCGAGAGGCAGCG- 420


3793R-2.IR_full       421 AATCGAGCGGCTGGAAATGCTGGACGAGGGTGAACTGCTGCTTCAGCTCTTCCAGCACTA 480
                          |||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||
3793R-2.in silico     421 AATCGAGCGGCTGGAAATGCTGGACGAGGGTGAACTGCTGCTCCAGCTTTTCCAGCACTA 480


3793R-2.IR_full       481 CTGCCTGGTGGTCGCCNGNACTCT 504
                          |||||||||||||||       ||
3793R-2.in silico     481 CTGCCTGGTGGTCGC-------CT 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   474  NM_135922.2  CG3793-RA (CG3793), mRNA 
0.63   NM_137056.2  CG13340-RA (CG13340), mRNA 
0.63   NM_140137.2  CG32063-RA, transcript variant A (CG32063), mRNA 
0.63   NM_168410.1  CG32063-RB, transcript variant B (CG32063), mRNA 
0.42   NM_079520.3  CG15581-RA (Or83c), mRNA 
0   NM_079143.2  CG3340-RA (Kr), mRNA 
0   NM_139954.1  CG7083-RA (CG7083), mRNA 
0   NM_142296.2  CG14899-RA (CG14899), mRNA 
0   NM_136608.2  CG8777-RA (CG8777), mRNA 
0   10  NM_139732.2  CG10542-RA (CG10542), mRNA 
0   NM_142674.2  CG10827-RA (CG10827), mRNA 
0   NM_140463.3  CG9384-RA (CG9384), mRNA 
0   NM_143302.1  CG14264-RA (CG14264), mRNA 
0   NM_001042872.1  CG14042-RB, transcript variant B (CG14042), mRNA 
0   NM_001042871.1  CG14042-RA, transcript variant A (CG14042), mRNA 
0   NM_144359.2  CG14041-RB, transcript variant B (SP555), mRNA 
0   NM_164618.1  CG14041-RA, transcript variant A (SP555), mRNA 
0   NM_170365.1  CG14066-RC, transcript variant C (larp), mRNA 
0   NM_170366.1  CG14066-RB, transcript variant B (larp), mRNA 
0   NM_080259.1  CG14066-RA, transcript variant A (larp), mRNA 
0   NM_132858.2  CG9056-RA (CG9056), mRNA 
0   NM_140289.2  CG17153-RA (CG17153), mRNA 
0   NM_142822.1  CG4917-RA, transcript variant A (wfs1), mRNA 
0   NM_170035.1  CG4917-RB, transcript variant B (wfs1), mRNA 
0   NM_206513.1  CG14307-RL, transcript variant L (fru), mRNA 
0   NM_079827.2  CG7788-RA (Ice), mRNA 
0   NM_057843.2  CG14029-RA, transcript variant A (vri), mRNA 
0   NM_164639.1  CG14029-RC, transcript variant C (vri), mRNA 
0   NM_166563.1  CG30274-RA (CG30274), mRNA 
0   NM_143452.1  CG1911-RA (CAP-D2), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.