National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3758R-5 
 Symbol esg  Full Name escargot 
 CG No CG3758  Old CG No CG3758 
 Synonyms CG3758, BG:DS07851.7, l(2)35Ce, l(2)br43, wiz, l(2)esg, l35Ce, dgl, 4B7, br43, shof, l(2)4B7, l(2)07082, flg, esg 
 Accession No (Link to NCBI) NM_057252.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male lethal 
 Map Viewer
 Reference
[Please submit your publication]
Wu C, Li Z, Ding X, Guo X, Sun Y, Wang X, Hu Y, Li T, La X, Li J, Li JA, Li W, Xue L.
Snail modulates JNK-mediated cell death in Drosophila.
Cell Death Dis (2019) 10(12) 893 [ PubMed ID = 31772150 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGAAAATCCCTCCGAGGAACT 
 Primer Seq. 3'
aatctagaggtaccTCGGATAACCGGGCATCTGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGAAAATCCC TCCGAGGAAC TGATCAACGT CAGCGATTGT TGCGAGGACG AGGGTGTGGA 
0061 TGTAGATCAT ACAGATGATG AACACATCGA GGAGGAGGAC GAGGACGTCG ATGTGGATGT 
0121 GGACTCGGAC CCAAATCAGA CCCAGGCTGC GGCTTTANNT GCTGCCGCAG CTGTGGCCGC 
0181 TGCTGCAGCC GCCTCCGTGG TTGTGCCCAC GCCCACATAC CCGAAATATC CATGGAACAA 
0241 CTTCCACATG TCGCCCTACA CCGCCGAGTT CTACAGGACC ATCAATCAGC CGGGTCATCA 
0301 GATTTTGCCG CTGCGTGGCG ATCTCATTGC GCCCAGTTCG CCGAGTGACT TCGCTGGGCT 
0361 CCCTGTCGCC GCCACCACAT CATTACCTTC ATGGTCGCGC AAGCTCCGTT TCCCCGCCCA 
0421 TGAGATCGGA AATCATCCAT AGACCAATCG GCGTGCGGCA GCACCGNTTT TCCTGCCCTA 
0481 TCCACAGATG CCCGGTTATC CGNGTA 
 in silico PCR Fragment
0001 GGAAAATCCC TCCGAGGAAC TGATCAACGT CAGCGATTGT TGCGAGGACG AGGGTGTGGA 
0061 TGTAGATCAT ACAGATGATG AACACATCGA GGAGGAGGAC GAGGACGTCG ATGTGGATGT 
0121 GGACTCGGAC CCAAATCAGA CCCAGGCTGC GGCTTTAGCT GCTGCCGCAG CTGTGGCCGC 
0181 CGCTGCAGCC GCCTCCGTGG TTGTGCCCAC GCCCACATAC CCGAAATATC CCTGGAACAA 
0241 CTTCCACATG TCGCCCTACA CCGCCGAGTT CTACAGGACC ATCAATCAGC AGGGTCATCA 
0301 GATTTTGCCG CTGCGTGGCG ATCTCATTGC GCCCAGTTCG CCGAGTGAC- TCGCTGGGCT 
0361 CCCTGTCGCC GCCACCACAT CATTACCTTC ATGGTCGCGC AAGCTCCGTT TCCCCGCCCA 
0421 TGAGATCTGA AATCATCCAT AGACCAATCG GCGTGCGGCA GCACCG--TT TCCTGCCCTA 
0481 TCCACAGATG CCCGGTTATC CG---A 
 Assemble Data

3758R-5.IR_full       1   GGAAAATCCCTCCGAGGAACTGATCAACGTCAGCGATTGTTGCGAGGACGAGGGTGTGGA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3758R-5.in silico     1   GGAAAATCCCTCCGAGGAACTGATCAACGTCAGCGATTGTTGCGAGGACGAGGGTGTGGA 60


3758R-5.IR_full       61  TGTAGATCATACAGATGATGAACACATCGAGGAGGAGGACGAGGACGTCGATGTGGATGT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3758R-5.in silico     61  TGTAGATCATACAGATGATGAACACATCGAGGAGGAGGACGAGGACGTCGATGTGGATGT 120


3758R-5.IR_full       121 GGACTCGGACCCAAATCAGACCCAGGCTGCGGCTTTANNTGCTGCCGCAGCTGTGGCCGC 180
                          |||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||
3758R-5.in silico     121 GGACTCGGACCCAAATCAGACCCAGGCTGCGGCTTTAGCTGCTGCCGCAGCTGTGGCCGC 180


3758R-5.IR_full       181 TGCTGCAGCCGCCTCCGTGGTTGTGCCCACGCCCACATACCCGAAATATCCATGGAACAA 240
                           |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
3758R-5.in silico     181 CGCTGCAGCCGCCTCCGTGGTTGTGCCCACGCCCACATACCCGAAATATCCCTGGAACAA 240


3758R-5.IR_full       241 CTTCCACATGTCGCCCTACACCGCCGAGTTCTACAGGACCATCAATCAGCCGGGTCATCA 300
                          |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
3758R-5.in silico     241 CTTCCACATGTCGCCCTACACCGCCGAGTTCTACAGGACCATCAATCAGCAGGGTCATCA 300


3758R-5.IR_full       301 GATTTTGCCGCTGCGTGGCGATCTCATTGCGCCCAGTTCGCCGAGTGACTTCGCTGGGCT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
3758R-5.in silico     301 GATTTTGCCGCTGCGTGGCGATCTCATTGCGCCCAGTTCGCCGAGTGAC-TCGCTGGGCT 360


3758R-5.IR_full       361 CCCTGTCGCCGCCACCACATCATTACCTTCATGGTCGCGCAAGCTCCGTTTCCCCGCCCA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3758R-5.in silico     361 CCCTGTCGCCGCCACCACATCATTACCTTCATGGTCGCGCAAGCTCCGTTTCCCCGCCCA 420


3758R-5.IR_full       421 TGAGATCGGAAATCATCCATAGACCAATCGGCGTGCGGCAGCACCGNTTTTCCTGCCCTA 480
                          ||||||| ||||||||||||||||||||||||||||||||||||||  ||||||||||||
3758R-5.in silico     421 TGAGATCTGAAATCATCCATAGACCAATCGGCGTGCGGCAGCACCG--TTTCCTGCCCTA 480


3758R-5.IR_full       481 TCCACAGATGCCCGGTTATCCGNGTA 506
                          ||||||||||||||||||||||   |
3758R-5.in silico     481 TCCACAGATGCCCGGTTATCCG---A 506

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  10  NM_057252.3  CG3758-RA (esg), mRNA 
0.41   NM_139707.1  CG15214-RA (CG15214), mRNA 
0.41   10  NM_139802.2  CG32392-RB, transcript variant B (CG32392), mRNA 
0.2   NM_134738.2  CG4887-RA (CG4887), mRNA 
0.2   12  NM_078859.2  CG5813-RA, transcript variant A (chif), mRNA 
0.2   12  NM_165156.1  CG5813-RB, transcript variant B (chif), mRNA 
0.2   12  NM_142899.1  CG10152-RA (beat-IV), mRNA 
0.2   NM_132084.2  CG12219-RA (CG12219), mRNA 
0.2   14  NM_134962.2  CG31772-RA (CG31772), mRNA 
0.2   NM_139363.1  CG7852-RA, transcript variant A (CG7852), mRNA 
0.2   NM_206232.1  CG7852-RC, transcript variant C (CG7852), mRNA 
0.2   NM_167890.1  CG7852-RB, transcript variant B (CG7852), mRNA 
0.2   NM_135870.3  CG4218-RA (CG4218), mRNA 
0   23  149  189  NM_078751.3  CG3047-RA (Sgs1), mRNA 
0   20  83  NM_132412.1  CG9817-RA (CG9817), mRNA 
0   22  83  NM_080025.1  CG11387-RA, transcript variant A (ct), mRNA 
0   15  13  NM_206564.1  CG5794-RE, transcript variant E (CG5794), mRNA 
0   15  13  NM_143018.2  CG5794-RD, transcript variant D (CG5794), mRNA 
0   15  13  NM_170158.1  CG5794-RB, transcript variant B (CG5794), mRNA 
0   17  NM_165667.1  CG2040-RA, transcript variant A (hig), mRNA 
0   17  NM_165666.1  CG2040-RB, transcript variant B (hig), mRNA 
0   17  NM_001014514.1  CG2040-RD, transcript variant D (hig), mRNA 
0   17  NM_080371.2  CG2040-RC, transcript variant C (hig), mRNA 
0   13  12  NM_135112.1  CG11030-RA (CG11030), mRNA 
0   12  NM_057645.2  CG10844-RC, transcript variant C (Rya-r44F), mRNA 
0   12  NM_057644.2  CG10844-RB, transcript variant B (Rya-r44F), mRNA 
0   12  NM_057643.2  CG10844-RA, transcript variant A (Rya-r44F), mRNA 
0   12  NM_057646.2  CG10844-RD, transcript variant D (Rya-r44F), mRNA 
0   18  59  NM_167685.1  CG12701-RB, transcript variant B (CG12701), mRNA 
0   18  59  NM_134512.4  CG12701-RA, transcript variant A (CG12701), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.