National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3757R-5 
 Symbol Full Name yellow 
 CG No CG3757  Old CG No CG3757 
 Synonyms EG:125H10.2, CG3757, T6, y 
 Accession No (Link to NCBI) NM_057444.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees yellow body color 
 Map Viewer
 Reference
[Please submit your publication]
Rai M, Coleman Z, Curley M, Nityanandam A, Platt A, Robles-Murguia M, Jiao J, Finkelstein D, Wang YD, Xu B, Fan Y, Demontis F.
Proteasome stress in skeletal muscle mounts a long-range protective response that delays retinal and brain aging.
Cell Metab (2021) [ PubMed ID = 33773104 ] [ RRC reference ]

Minami R, Sato C, Yamahama Y, Kubo H, Hariyama T, Kimura KI.
An RNAi Screen for Genes Involved in Nanoscale Protrusion Formation on Corneal Lens in Drosophila melanogaster.
Zoolog Sci (2016) 33(6) 583-591 [ PubMed ID = 27927092 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGACAAAGGGTGGATCCTTGTG 
 Primer Seq. 3'
aatctagaggtaccAGCTCGTATCTCCGAATTCGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GACAAAGGGT GGATCCTTGT GACCCTGATC ACCTTGGTGA CGCCGTCTTG GGCTGCTTAC 
0061 AAACTTCAGG AGCGATATAG TTGGAGCCAG CTGGACTTTG CTTTCCCGAA TACCCGACTA 
0121 AAGGACCAAG CTCTGGCTAG TGGAGATTAT ATTCCGCAAA ATGCTCTACC TGTTGGAGTC 
0181 GAACACTTTG GCAATCGGTT ATTCGTCACT GTTCCCCGCT GGCGTGATGG GATTCCGGCC 
0241 ACTCTGACCT ATATAAACAT GGACCGCAGT TTGACGGGTT CACCGGAGCT AATTCCGTAT 
0301 CCAGATTGGC GCTCAAATAC AGCTGGAGAT TGCGCCAACA GTATTACCAC TGCCTACCGC 
0361 ATTAAAGTGG ATGAGTGTGG TCGGCTGTGG GTTTTGGACA CTGGAANCCG TGGGCATCGG 
0421 CAATACCACC ACTAATCCGT GCCCCTATGC GGTAAATGTC TTTGACTTGA CCACGGATAC 
0481 GCGAATTCGG AGATACGAGC T 
 in silico PCR Fragment
0001 GACAAAGGGT GGATCCTTGT GACCCTGATC ACCTTGGTGA CGCCGTCTTG GGCTGCTTAC 
0061 AAACTTCAGG AGCGATATAG TTGGAGCCAG CTGGACTTTG CTTTCCCGAA TACCCGACTA 
0121 AAGGACCAAG CTCTGGCTAG TGGAGATTAT ATTCCGCAAA ATGCTCTACC TGTTGGAGTC 
0181 GAACACTTTG GCAATCGGTT ATTCGTCACT GTTCCCCGCT GGCGTGATGG GATTCCGGCC 
0241 ACTCTGACCT ATATAAACAT GGACCGCAGT TTGACGGGTT CACCGGAGCT AATTCCGTAT 
0301 CCAGATTGGC GCTCAAATAC AGCTGGAGAT TGCGCCAACA GTATTACCAC TGCCTACCGC 
0361 ATTAAAGTGG ATGAGTGTGG TCGGCTGTGG GTTTTGGACA CTGGAA-CCG TGGGCATCGG 
0421 CAATACCACC ACTAATCCGT GCCCCTATGC GGTAAATGTC TTTGACTTGA CCACGGATAC 
0481 GCGAATTCGG AGATACGAGC T 
 Assemble Data

3757R-5.IR_full       1   GACAAAGGGTGGATCCTTGTGACCCTGATCACCTTGGTGACGCCGTCTTGGGCTGCTTAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3757R-5.in silico     1   GACAAAGGGTGGATCCTTGTGACCCTGATCACCTTGGTGACGCCGTCTTGGGCTGCTTAC 60


3757R-5.IR_full       61  AAACTTCAGGAGCGATATAGTTGGAGCCAGCTGGACTTTGCTTTCCCGAATACCCGACTA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3757R-5.in silico     61  AAACTTCAGGAGCGATATAGTTGGAGCCAGCTGGACTTTGCTTTCCCGAATACCCGACTA 120


3757R-5.IR_full       121 AAGGACCAAGCTCTGGCTAGTGGAGATTATATTCCGCAAAATGCTCTACCTGTTGGAGTC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3757R-5.in silico     121 AAGGACCAAGCTCTGGCTAGTGGAGATTATATTCCGCAAAATGCTCTACCTGTTGGAGTC 180


3757R-5.IR_full       181 GAACACTTTGGCAATCGGTTATTCGTCACTGTTCCCCGCTGGCGTGATGGGATTCCGGCC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3757R-5.in silico     181 GAACACTTTGGCAATCGGTTATTCGTCACTGTTCCCCGCTGGCGTGATGGGATTCCGGCC 240


3757R-5.IR_full       241 ACTCTGACCTATATAAACATGGACCGCAGTTTGACGGGTTCACCGGAGCTAATTCCGTAT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3757R-5.in silico     241 ACTCTGACCTATATAAACATGGACCGCAGTTTGACGGGTTCACCGGAGCTAATTCCGTAT 300


3757R-5.IR_full       301 CCAGATTGGCGCTCAAATACAGCTGGAGATTGCGCCAACAGTATTACCACTGCCTACCGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3757R-5.in silico     301 CCAGATTGGCGCTCAAATACAGCTGGAGATTGCGCCAACAGTATTACCACTGCCTACCGC 360


3757R-5.IR_full       361 ATTAAAGTGGATGAGTGTGGTCGGCTGTGGGTTTTGGACACTGGAANCCGTGGGCATCGG 420
                          |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
3757R-5.in silico     361 ATTAAAGTGGATGAGTGTGGTCGGCTGTGGGTTTTGGACACTGGAA-CCGTGGGCATCGG 420


3757R-5.IR_full       421 CAATACCACCACTAATCCGTGCCCCTATGCGGTAAATGTCTTTGACTTGACCACGGATAC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3757R-5.in silico     421 CAATACCACCACTAATCCGTGCCCCTATGCGGTAAATGTCTTTGACTTGACCACGGATAC 480


3757R-5.IR_full       481 GCGAATTCGGAGATACGAGCT 501
                          |||||||||||||||||||||
3757R-5.in silico     481 GCGAATTCGGAGATACGAGCT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057444.3  CG3757-RA (y), mRNA 
0   NM_001032231.1  CG18003-RA, transcript variant A (CG18003), mRNA 
0   NM_001032232.1  CG11919-RA, transcript variant A (CG11919), mRNA 
0   NM_170399.1  CG11897-RA, transcript variant A (CG11897), mRNA 
0   NM_143421.2  CG11897-RB, transcript variant B (CG11897), mRNA 
0   NM_168439.1  CG6297-RA, transcript variant A (JIL-1), mRNA 
0   NM_140175.2  CG6297-RB, transcript variant B (JIL-1), mRNA 
0   NM_141732.1  CG3999-RA (CG3999), mRNA 
0   NM_058041.2  CG12467-RA (CG12467), mRNA 
0   NM_136536.2  CG2110-RA (Cyp4ad1), mRNA 
0   NM_001043265.1  CG34139-RA (CG34139), mRNA 
0   NM_168121.1  CG10625-RC, transcript variant C (CG10625), mRNA 
0   NM_168120.1  CG10625-RB, transcript variant B (CG10625), mRNA 
0   NM_079419.2  CG4059-RB, transcript variant B (ftz-f1), mRNA 
0   NM_140395.1  CG10116-RA (CG10116), mRNA 
0   NM_168775.1  CG4059-RA, transcript variant A (ftz-f1), mRNA 
0   NM_170582.2  CG31000-RA, transcript variant A (heph), mRNA 
0   NM_176597.1  CG31000-RE, transcript variant E (heph), mRNA 
0   NM_176601.1  CG31000-RJ, transcript variant J (heph), mRNA 
0   NM_176600.1  CG31000-RI, transcript variant I (heph), mRNA 
0   NM_136180.2  CG10756-RA (Taf13), mRNA 
0   NM_080269.2  CG9481-RA (Ugt37b1), mRNA 
0   NM_141639.1  CG16779-RA (CG16779), mRNA 
0   NM_136103.2  CG10563-RA (CG10563), mRNA 
0   NM_133076.2  CG6470-RA (CG6470), mRNA 
0   NM_132074.1  CG3585-RA (CG3585), mRNA 
0   NM_169943.1  CG31207-RA (CG31207), mRNA 
0   NM_140842.1  CG9629-RA (CG9629), mRNA 
0   NM_132791.2  CG12608-RA (CG12608), mRNA 
0   NM_078783.2  CG7068-RA (TepIII), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.