National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3724R-2 
 Symbol Pgd  Full Name Phosphogluconate dehydrogenase 
 CG No CG3724  Old CG No CG3724 
 Synonyms 6PGDH, 6-Pgd, 6-PGD, CG3724, EG:87B1.4, 6-pgd, Pdg, 6Pgdh, l(1)G0385, 6Pgd, l(1)Pgd, 6PGD, PGD, l(1)2De, l(1)2Dc, l35, N1, l(1)A7, A7, l(1)Pgd-A, l(1)N3[90], l(1)N1, Pgd, 6pgdh 
 Accession No (Link to NCBI) NM_057512.3 
 Inserted Chr. ll 
 Insertional Mutation  3 lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACTCAACATGGACGAGAAGGG 
 Primer Seq. 3'
aatctagaggtaccGCACCATCTTGACGAAGTGAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACTCAACATG GACGAGAAGG GATTCGTGGT GTGCGCCTAC AACCGCACGG TGGCCAAGGT 
0061 CAAGGAGTTC CTCGCCAATG AGGCTAAGGA CACCAAAGTG ATTGGAGCCG ACTCGCTCGA 
0121 GGACATGGTC TCCAAGCTGA AGAGCCCCCG GAAGGTCATG CTGCTGGTCA AGGCTGGAAG 
0181 TGCAGTCGAC GACTTCATCC AGCAGCTGGT GCCGCTGCTT TCCGCCGGCG ATGTGATCAT 
0241 CGATGGTGGC AACTCGGAGT ATCAGGACAC ATCTCGCCGC TGCGACGAGT TAGCCAAACT 
0301 TGGCCTGCTC TTCGTCGGAT CCGGCGTGAG CGGTGGCGAG GAGGGCGCCC GCCACGGACC 
0361 CTCGCTGATG CCCGGCGGAC ACGAGGCCGC GTGGCCCCTT ATCCAACCCA TCTTCCAGGC 
0421 GATCTGCgCC AAGGCCGACG GTGAACCCTG CTGCGAGTGG GTGGGCGATG GAGGCGCCGG 
0481 TCaNTTCGTC AAGATGGTGC  
 in silico PCR Fragment
0001 ACTCAACATG GACGAGAAGG GATTCGTGGT GTGCGCCTAC AACCGCACGG TGGCCAAGGT 
0061 CAAGGAGTTC CTCGCCAATG AGGCTAAGGA CACCAAAGTG ATTGGAGCCG ACTCGCTCGA 
0121 GGACATGGTC TCCAAGCTGA AGAGCCCCCG GAAGGTCATG CTGCTGGTCA AGGCTGGAAG 
0181 TGCAGTCGAC GACTTCATCC AGCAGCTGGT GCCGCTGCTT TCCGCCGGCG ATGTGATCAT 
0241 CGATGGTGGC AACTCGGAGT ATCAGGACAC ATCTCGCCGC TGCGACGAGT TAGCCAAACT 
0301 TGGCCTGCTC TTCGTCGGAT CCGGCGTGAG CGGTGGCGAG GAGGGCGCCC GCCACGGACC 
0361 CTCGCTGATG CCCGGCGGAC ACGAGGCCGC GTGGCCCCTT ATCCAACCCA TCTTCCAGGC 
0421 GATCTGCGCC AAGGCCGACG GTGAACCCTG CTGCGAGTGG GTGGGCGATG GAGGCGCCGG 
0481 TCACTTCGTC AAGATGGTGC  
 Assemble Data

3724R-2.IR_full       1   ACTCAACATGGACGAGAAGGGATTCGTGGTGTGCGCCTACAACCGCACGGTGGCCAAGGT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3724R-2.in silico     1   ACTCAACATGGACGAGAAGGGATTCGTGGTGTGCGCCTACAACCGCACGGTGGCCAAGGT 60


3724R-2.IR_full       61  CAAGGAGTTCCTCGCCAATGAGGCTAAGGACACCAAAGTGATTGGAGCCGACTCGCTCGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3724R-2.in silico     61  CAAGGAGTTCCTCGCCAATGAGGCTAAGGACACCAAAGTGATTGGAGCCGACTCGCTCGA 120


3724R-2.IR_full       121 GGACATGGTCTCCAAGCTGAAGAGCCCCCGGAAGGTCATGCTGCTGGTCAAGGCTGGAAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3724R-2.in silico     121 GGACATGGTCTCCAAGCTGAAGAGCCCCCGGAAGGTCATGCTGCTGGTCAAGGCTGGAAG 180


3724R-2.IR_full       181 TGCAGTCGACGACTTCATCCAGCAGCTGGTGCCGCTGCTTTCCGCCGGCGATGTGATCAT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3724R-2.in silico     181 TGCAGTCGACGACTTCATCCAGCAGCTGGTGCCGCTGCTTTCCGCCGGCGATGTGATCAT 240


3724R-2.IR_full       241 CGATGGTGGCAACTCGGAGTATCAGGACACATCTCGCCGCTGCGACGAGTTAGCCAAACT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3724R-2.in silico     241 CGATGGTGGCAACTCGGAGTATCAGGACACATCTCGCCGCTGCGACGAGTTAGCCAAACT 300


3724R-2.IR_full       301 TGGCCTGCTCTTCGTCGGATCCGGCGTGAGCGGTGGCGAGGAGGGCGCCCGCCACGGACC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3724R-2.in silico     301 TGGCCTGCTCTTCGTCGGATCCGGCGTGAGCGGTGGCGAGGAGGGCGCCCGCCACGGACC 360


3724R-2.IR_full       361 CTCGCTGATGCCCGGCGGACACGAGGCCGCGTGGCCCCTTATCCAACCCATCTTCCAGGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3724R-2.in silico     361 CTCGCTGATGCCCGGCGGACACGAGGCCGCGTGGCCCCTTATCCAACCCATCTTCCAGGC 420


3724R-2.IR_full       421 GATCTGCGCCAAGGCCGACGGTGAACCCTGCTGCGAGTGGGTGGGCGATGGAGGCGCCGG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3724R-2.in silico     421 GATCTGCGCCAAGGCCGACGGTGAACCCTGCTGCGAGTGGGTGGGCGATGGAGGCGCCGG 480


3724R-2.IR_full       481 TCANTTCGTCAAGATGGTGC 500
                          ||| ||||||||||||||||
3724R-2.in silico     481 TCACTTCGTCAAGATGGTGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057512.3  CG3724-RA (Pgd), mRNA 
0.2   NM_057328.3  CG3127-RA (Pgk), mRNA 
0.2   NM_170430.2  CG31037-RA (ca), mRNA 
0   NM_142988.2  CG5728-RA (CG5728), mRNA 
0   NM_176130.3  CG12052-RJ, transcript variant J (lola), mRNA 
0   NM_079293.2  CG8091-RA (Nc), mRNA 
0   NM_140043.3  CG4347-RA, transcript variant A (UGP), mRNA 
0   NM_168325.2  CG4347-RC, transcript variant C (UGP), mRNA 
0   NM_169641.2  CG4898-RI, transcript variant I (Tm1), mRNA 
0   NM_169640.1  CG4898-RC, transcript variant C (Tm1), mRNA 
0   NM_169639.2  CG4898-RH, transcript variant H (Tm1), mRNA 
0   NM_169638.2  CG4898-RE, transcript variant E (Tm1), mRNA 
0   NM_176553.1  CG6129-RC, transcript variant C (CG6129), mRNA 
0   NM_142959.2  CG6129-RB, transcript variant B (CG6129), mRNA 
0   NM_170189.1  CG31115-RA (CG31115), mRNA 
0   NM_168195.1  CG32387-RB, transcript variant B (CG32387), mRNA 
0   NM_168196.1  CG32387-RA, transcript variant A (CG32387), mRNA 
0   NM_001043123.1  CG32387-RC, transcript variant C (CG32387), mRNA 
0   NM_140688.2  CG7728-RA (CG7728), mRNA 
0   NM_176753.1  CG6835-RD, transcript variant D (GS), mRNA 
0   NM_176752.1  CG6835-RC, transcript variant C (GS), mRNA 
0   NM_167591.1  CG32495-RC, transcript variant C (CG32495), mRNA 
0   NM_167589.1  CG32495-RB, transcript variant B (CG32495), mRNA 
0   NM_167590.1  CG32495-RA, transcript variant A (CG32495), mRNA 
0   13  NM_079561.2  CG9755-RC, transcript variant C (pum), mRNA 
0   13  NM_169259.1  CG9755-RD, transcript variant D (pum), mRNA 
0   13  NM_169258.1  CG9755-RA, transcript variant A (pum), mRNA 
0   NM_176427.1  CG9755-RE, transcript variant E (pum), mRNA 
0   NM_169260.1  CG9755-RB, transcript variant B (pum), mRNA 
0   NM_206343.1  CG5620-RB, transcript variant B (CG5620), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.