National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3724R-1 
 Symbol Pgd  Full Name Phosphogluconate dehydrogenase 
 CG No CG3724  Old CG No CG3724 
 Synonyms 6PGDH, 6-Pgd, 6-PGD, CG3724, EG:87B1.4, 6-pgd, Pdg, 6Pgdh, l(1)G0385, 6Pgd, l(1)Pgd, 6PGD, PGD, l(1)2De, l(1)2Dc, l35, N1, l(1)A7, A7, l(1)Pgd-A, l(1)N3[90], l(1)N1, Pgd, 6pgdh 
 Accession No (Link to NCBI) NM_057512.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ACTCAACATGGACGAGAAGGGATTCGTGGTGTGCGCCTACAACCGCACGGTGGCCAAGGT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CAAGGAGTTCCTCGCCAATGAGGCTAAGGACACCAAAGTGATTGGAGCCGACTCGCTCGA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GGACATGGTCTCCAAGCTGAAGAGCCCCCGGAAGGTCATGCTGCTGGTCAAGGCTGGAAG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TGCAGTCGACGACTTCATCCAGCAGCTGGTGCCGCTGCTTTCCGCCGGCGATGTGATCAT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CGATGGTGGCAACTCGGAGTATCAGGACACATCTCGCCGCTGCGACGAGTTAGCCAAACT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TGGCCTGCTCTTCGTCGGATCCGGCGTGAGCGGTGGCGAGGAGGGCGCCCGCCACGGACC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CTCGCTGATGCCCGGCGGACACGAGGCCGCGTGGCCCCTTATCCAACCCATCTTCCAGGC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GATCTGCGCCAAGGCCGACGGTGAACCCTGCTGCGAGTGGGTGGGCGATGGAGGCGCCGG 480

3724R-1.IR_full       481 TCANTTCGTCAAGATGGTGC 500
                          ||| |||||||||||||||| silico     481 TCACTTCGTCAAGATGGTGC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057512.3  CG3724-RA (Pgd), mRNA 
0.2   NM_057328.3  CG3127-RA (Pgk), mRNA 
0.2   NM_170430.2  CG31037-RA (ca), mRNA 
0   NM_142988.2  CG5728-RA (CG5728), mRNA 
0   NM_176130.3  CG12052-RJ, transcript variant J (lola), mRNA 
0   NM_079293.2  CG8091-RA (Nc), mRNA 
0   NM_140043.3  CG4347-RA, transcript variant A (UGP), mRNA 
0   NM_168325.2  CG4347-RC, transcript variant C (UGP), mRNA 
0   NM_169641.2  CG4898-RI, transcript variant I (Tm1), mRNA 
0   NM_169640.1  CG4898-RC, transcript variant C (Tm1), mRNA 
0   NM_169639.2  CG4898-RH, transcript variant H (Tm1), mRNA 
0   NM_169638.2  CG4898-RE, transcript variant E (Tm1), mRNA 
0   NM_176553.1  CG6129-RC, transcript variant C (CG6129), mRNA 
0   NM_142959.2  CG6129-RB, transcript variant B (CG6129), mRNA 
0   NM_170189.1  CG31115-RA (CG31115), mRNA 
0   NM_168195.1  CG32387-RB, transcript variant B (CG32387), mRNA 
0   NM_168196.1  CG32387-RA, transcript variant A (CG32387), mRNA 
0   NM_001043123.1  CG32387-RC, transcript variant C (CG32387), mRNA 
0   NM_140688.2  CG7728-RA (CG7728), mRNA 
0   NM_176753.1  CG6835-RD, transcript variant D (GS), mRNA 
0   NM_176752.1  CG6835-RC, transcript variant C (GS), mRNA 
0   NM_167591.1  CG32495-RC, transcript variant C (CG32495), mRNA 
0   NM_167589.1  CG32495-RB, transcript variant B (CG32495), mRNA 
0   NM_167590.1  CG32495-RA, transcript variant A (CG32495), mRNA 
0   13  NM_079561.2  CG9755-RC, transcript variant C (pum), mRNA 
0   13  NM_169259.1  CG9755-RD, transcript variant D (pum), mRNA 
0   13  NM_169258.1  CG9755-RA, transcript variant A (pum), mRNA 
0   NM_176427.1  CG9755-RE, transcript variant E (pum), mRNA 
0   NM_169260.1  CG9755-RB, transcript variant B (pum), mRNA 
0   NM_206343.1  CG5620-RB, transcript variant B (CG5620), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.