National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3715R-2 
 Symbol Shc  Full Name SHC-adaptor protein 
 CG No CG3715  Old CG No CG3715 
 Synonyms dshc, shc, DSHC, D-Shc, dShc, CG3715, Shc 
 Accession No (Link to NCBI) NM_079944.2 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACCAGCGACGGCTGCATCTAT 
 Primer Seq. 3'
aatctagaggtaccCTGAGAGCGTTGAAGCGCAAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACCAGCGACG GCTGCATCTA TCCGGACGAC GTCATAATGG GCGTGGGTGT TGCATTCAAC 
0061 GTGCGGTACA CGGGATGCGT TGAGGTCAAG ACCTCAATGA AATCCCTGGA CTTCGAGACC 
0121 CGTACGCAGT NTGGCGCGAG AGTGCATCAA TCGAGTTTGC GAGGCGGCCG GTTTAAAGTC 
0181 TGCTGGCAAG CGGAGATTAA CCAACTTCAT ATCGGATCGA CCCAGCATGC ANGCACGCCG 
0241 GCACCAACAT CATCATTAAT GTANTCGAGC CGTGCTCTGT CGCTGAGCAA CGTGGAAACG 
0301 GGCGAGGTTA TAGCCAATCA CAATATGCCG CGCATATCGT TCGCGTCCGG CGGTGACAAT 
0361 GACACCCTCG ACTTCCTCGC CTACATAGCC AAGAATGAGG ATGAATGGCG GGCATGTTAT 
0421 GTCCTGGAAT GCGCTGGCGG CNCAAAGCGA GGATCTAATA GTGACCATTG GCAAGGCGTT 
0481 TGcCTTGCgC TTCAACGCTC TCAG 
 in silico PCR Fragment
0001 ACCAGCGACG GCTGCATCTA TCCGGACGAC GTCATAATGG GCGTGGGTGT TGCATTCAAC 
0061 GTGCGGTACA CGGGATGCGT TGAGGTCAAG ACCTCAATGA AATCCCTGGA CTTCGAGACC 
0121 CGTACGCAGT -TAGCGCGAG AGTGCATCAA TCGAGTTTGC GAGGCGGCCG GTTTAAAGTC 
0181 TGCTGGCAAG CGGAGATTAA CCAACTTCAT ATCGGATCGA CCCAGCATGC A-GCACGCCG 
0241 GCACCAACAT CATCATTAAT GTA-TCGAGC CGTGCTCTGT CGCTAAGCAA CGTGGAAACG 
0301 GGCGAGGTTA TAGCCAATCA CAATATGCCG CGCATATCGT TCGCGTCCGG CGGTGACAAT 
0361 GACACCCTCG ACTTCCTCGC CTACATAGCC AAGAATGAGG ATGAATGGCG GGCATGTTAT 
0421 GTCCTGGAAT GCGCTGGCGG C-CAAAGCGA GGATCTAATA GTGACCATTG GCAAGGCGTT 
0481 TGCCTTGCGC TTCAACGCTC TCAG 
 Assemble Data

3715R-2.IR_full       1   ACCAGCGACGGCTGCATCTATCCGGACGACGTCATAATGGGCGTGGGTGTTGCATTCAAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3715R-2.in silico     1   ACCAGCGACGGCTGCATCTATCCGGACGACGTCATAATGGGCGTGGGTGTTGCATTCAAC 60


3715R-2.IR_full       61  GTGCGGTACACGGGATGCGTTGAGGTCAAGACCTCAATGAAATCCCTGGACTTCGAGACC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3715R-2.in silico     61  GTGCGGTACACGGGATGCGTTGAGGTCAAGACCTCAATGAAATCCCTGGACTTCGAGACC 120


3715R-2.IR_full       121 CGTACGCAGTNTGGCGCGAGAGTGCATCAATCGAGTTTGCGAGGCGGCCGGTTTAAAGTC 180
                          |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||
3715R-2.in silico     121 CGTACGCAGT-TAGCGCGAGAGTGCATCAATCGAGTTTGCGAGGCGGCCGGTTTAAAGTC 180


3715R-2.IR_full       181 TGCTGGCAAGCGGAGATTAACCAACTTCATATCGGATCGACCCAGCATGCANGCACGCCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
3715R-2.in silico     181 TGCTGGCAAGCGGAGATTAACCAACTTCATATCGGATCGACCCAGCATGCA-GCACGCCG 240


3715R-2.IR_full       241 GCACCAACATCATCATTAATGTANTCGAGCCGTGCTCTGTCGCTGAGCAACGTGGAAACG 300
                          ||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||
3715R-2.in silico     241 GCACCAACATCATCATTAATGTA-TCGAGCCGTGCTCTGTCGCTAAGCAACGTGGAAACG 300


3715R-2.IR_full       301 GGCGAGGTTATAGCCAATCACAATATGCCGCGCATATCGTTCGCGTCCGGCGGTGACAAT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3715R-2.in silico     301 GGCGAGGTTATAGCCAATCACAATATGCCGCGCATATCGTTCGCGTCCGGCGGTGACAAT 360


3715R-2.IR_full       361 GACACCCTCGACTTCCTCGCCTACATAGCCAAGAATGAGGATGAATGGCGGGCATGTTAT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3715R-2.in silico     361 GACACCCTCGACTTCCTCGCCTACATAGCCAAGAATGAGGATGAATGGCGGGCATGTTAT 420


3715R-2.IR_full       421 GTCCTGGAATGCGCTGGCGGCNCAAAGCGAGGATCTAATAGTGACCATTGGCAAGGCGTT 480
                          ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
3715R-2.in silico     421 GTCCTGGAATGCGCTGGCGGC-CAAAGCGAGGATCTAATAGTGACCATTGGCAAGGCGTT 480


3715R-2.IR_full       481 TGCCTTGCGCTTCAACGCTCTCAG 504
                          ||||||||||||||||||||||||
3715R-2.in silico     481 TGCCTTGCGCTTCAACGCTCTCAG 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079944.2  CG3715-RA (Shc), mRNA 
0.2   NM_135255.1  CG13783-RA (CG13783), mRNA 
0   NM_135331.1  CG7367-RA (CG7367), mRNA 
0   NM_136372.2  CG3274-RA (Bap170), mRNA 
0   NM_165089.2  CG3479-RA, transcript variant A (osp), mRNA 
0   NM_078843.4  CG3479-RB, transcript variant B (osp), mRNA 
0   NM_168560.1  CG32132-RA (CG32132), mRNA 
0   NM_137794.2  CG11073-RA (CG11073), mRNA 
0   NM_001043270.1  CG5621-RB, transcript variant B (CG5621), mRNA 
0   NM_142670.2  CG5621-RA, transcript variant A (CG5621), mRNA 
0   NM_141691.1  CG8500-RA (CG8500), mRNA 
0   NM_176104.1  CG33087-RC (CG33087), mRNA 
0   NM_166694.1  CG9047-RC, transcript variant C (CG9047), mRNA 
0   NM_166693.1  CG9047-RB, transcript variant B (CG9047), mRNA 
0   NM_138131.2  CG9047-RA, transcript variant A (CG9047), mRNA 
0   NM_001042957.1  CG18140-RA (Cht3), mRNA 
0   23  NM_175960.3  CG33196-RB (dp), mRNA 
0   10  NM_139493.2  CG2083-RA (CG2083), mRNA 
0   NM_057215.3  CG4807-RB, transcript variant B (ab), mRNA 
0   NM_057214.3  CG4807-RA, transcript variant A (ab), mRNA 
0   NM_176713.1  CG10962-RA, transcript variant A (CG10962), mRNA 
0   NM_137934.2  CG9861-RA (CG9861), mRNA 
0   NM_134645.2  CG11376-RA (CG11376), mRNA 
0   NM_134984.2  CG3652-RA (CG3652), mRNA 
0   NM_206381.1  CG16838-RC, transcript variant C (CG16838), mRNA 
0   NM_206380.1  CG16838-RD, transcript variant D (CG16838), mRNA 
0   NM_078632.2  CG17336-RB, transcript variant B (Lcch3), mRNA 
0   NM_206746.1  CG17336-RC, transcript variant C (Lcch3), mRNA 
0   NM_167475.1  CG17336-RA, transcript variant A (Lcch3), mRNA 
0   NM_166991.2  CG32779-RA (CG32779), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.