National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3698R-3 
 Symbol CG3698  Full Name CG3698 
 CG No CG3698  Old CG No CG3698 
 Synonyms CG3698 
 Accession No (Link to NCBI) NM_141000.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAATCAACCGATCCCCATTGCG 
 Primer Seq. 3'
aatctagaggtaccGTCGATGATGGAATTTCGGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AATCAACCGA TCCCCATTGC GCCACCTCCA AGTCCAACCT GATCAAGGTG AACCACGTGG 
0061 GGGTGACGGC CAAGCTGCAG TCTCCCCTGA AGAAGATCTT CCCACGGCTG AACTCCTCCA 
0121 GCGATTCCGA CGCATATCAG CACAGTCAGA CGCAGTACAA CATGTTCAAG GATGTGGCGC 
0181 ACGGGGAAAT GACCGCGTCC ACGGATTCGG GGAGCTCACC ACACACTCTG TACGAGATGC 
0241 ACGCTGAGCC GGGGAAGAGT CAGCTTAGCC TGAGCAAGAG TAAGCCCCAA AGGATCGAGT 
0301 TCCAGCGTTA CTCCAAGCGC CGTCCCCGTG TGCTCGTCCC AACGAGNAAC TGCGCCGAAA 
0361 GTGAAGGGTC GTGCCACAAA GTCCCACAAA TCATCGCAGG CGCAGAAGCA GAAGCAGAAG 
0421 AGTGGCTTTC TAGCCCGTTT AGTGGAGTCG CTGGACAAGA TGTGCAAGTG CCAGCCGCAG 
0481 AGCCGAAATT CCATCATCGA C 
 in silico PCR Fragment
0001 AATCAACCGA TCCCCATTGC GCCACCTCCA AGTCCAACCT GATCAAGGTG AACCACGTGG 
0061 GGGTGACGGC CAAGCTGCAG TCTCCCCTGA AGAAGATCTT CCCACGGCTG AACTCCTCCA 
0121 GCGATTCCGA CGCATATCAG CACAGTCAGA CGCAGTACAA CATGTTCAAG GATGTGGCGC 
0181 ACGGGGAAAT GACCGCGTCC ACGGATTCGG GGAGCTCACC ACACACTCTG TACGAGATGC 
0241 ACGCTGAGCC GGGGAAGAGT CAGCTTAGCC TGAGCAAGAG CAAGCCCCAA AGGATCGAGT 
0301 TCCAGCGTTA CTCCAAGCGC CGTCCCCGTG TGCTCGTCCC AACGAG-AAC TGCGCCGAAA 
0361 GTGAAGGGTC GTGCCACAAA GTCCCACAAA TCATCGCAGG CGCAGAAGCA GAAGCAGAAG 
0421 AGTGGCTTTC TAGCCCGTTT AGTGGAGTCG CTGGACAAGA TGTGCAAGTG CCAGCCGCAG 
0481 AGCCGAAATT CCATCATCGA C 
 Assemble Data

3698R-3.IR_full       1   AATCAACCGATCCCCATTGCGCCACCTCCAAGTCCAACCTGATCAAGGTGAACCACGTGG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3698R-3.in silico     1   AATCAACCGATCCCCATTGCGCCACCTCCAAGTCCAACCTGATCAAGGTGAACCACGTGG 60


3698R-3.IR_full       61  GGGTGACGGCCAAGCTGCAGTCTCCCCTGAAGAAGATCTTCCCACGGCTGAACTCCTCCA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3698R-3.in silico     61  GGGTGACGGCCAAGCTGCAGTCTCCCCTGAAGAAGATCTTCCCACGGCTGAACTCCTCCA 120


3698R-3.IR_full       121 GCGATTCCGACGCATATCAGCACAGTCAGACGCAGTACAACATGTTCAAGGATGTGGCGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3698R-3.in silico     121 GCGATTCCGACGCATATCAGCACAGTCAGACGCAGTACAACATGTTCAAGGATGTGGCGC 180


3698R-3.IR_full       181 ACGGGGAAATGACCGCGTCCACGGATTCGGGGAGCTCACCACACACTCTGTACGAGATGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3698R-3.in silico     181 ACGGGGAAATGACCGCGTCCACGGATTCGGGGAGCTCACCACACACTCTGTACGAGATGC 240


3698R-3.IR_full       241 ACGCTGAGCCGGGGAAGAGTCAGCTTAGCCTGAGCAAGAGTAAGCCCCAAAGGATCGAGT 300
                          |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
3698R-3.in silico     241 ACGCTGAGCCGGGGAAGAGTCAGCTTAGCCTGAGCAAGAGCAAGCCCCAAAGGATCGAGT 300


3698R-3.IR_full       301 TCCAGCGTTACTCCAAGCGCCGTCCCCGTGTGCTCGTCCCAACGAGNAACTGCGCCGAAA 360
                          |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
3698R-3.in silico     301 TCCAGCGTTACTCCAAGCGCCGTCCCCGTGTGCTCGTCCCAACGAG-AACTGCGCCGAAA 360


3698R-3.IR_full       361 GTGAAGGGTCGTGCCACAAAGTCCCACAAATCATCGCAGGCGCAGAAGCAGAAGCAGAAG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3698R-3.in silico     361 GTGAAGGGTCGTGCCACAAAGTCCCACAAATCATCGCAGGCGCAGAAGCAGAAGCAGAAG 420


3698R-3.IR_full       421 AGTGGCTTTCTAGCCCGTTTAGTGGAGTCGCTGGACAAGATGTGCAAGTGCCAGCCGCAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3698R-3.in silico     421 AGTGGCTTTCTAGCCCGTTTAGTGGAGTCGCTGGACAAGATGTGCAAGTGCCAGCCGCAG 480


3698R-3.IR_full       481 AGCCGAAATTCCATCATCGAC 501
                          |||||||||||||||||||||
3698R-3.in silico     481 AGCCGAAATTCCATCATCGAC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141000.1  CG3698-RA (CG3698), mRNA 
0.41   16  11  NM_206778.1  CG5907-RC, transcript variant C (Frq2), mRNA 
0.41   16  11  NM_080354.2  CG5907-RA, transcript variant A (Frq2), mRNA 
0.41   16  11  NM_206779.1  CG5907-RB, transcript variant B (Frq2), mRNA 
0.2   NM_140824.1  CG11619-RA (CG11619), mRNA 
0   11  16  NM_057457.3  CG7109-RA (mts), mRNA 
0   NM_131985.2  CG4198-RA (CG4198), mRNA 
0   NM_176246.1  CG33143-RC, transcript variant C (CG33143), mRNA 
0   NM_057545.3  CG14513-RA (yemalpha), mRNA 
0   NM_139422.2  CG1017-RA (CG1017), mRNA 
0   NM_165245.2  CG31746-RA (CG31746), mRNA 
0   NM_057278.3  CG7727-RA (Appl), mRNA 
0   13  NM_169816.1  CG14307-RB, transcript variant B (fru), mRNA 
0   13  NM_079673.2  CG14307-RF, transcript variant F (fru), mRNA 
0   NM_134529.2  CG9575-RA (Rab35), mRNA 
0   18  NM_167685.1  CG12701-RB, transcript variant B (CG12701), mRNA 
0   17  NM_134512.4  CG12701-RA, transcript variant A (CG12701), mRNA 
0   17  NM_132413.1  CG15295-RA (CG15295), mRNA 
0   14  NM_134474.4  CG32532-RA (CG32532), mRNA 
0   11  NM_134724.2  CG4710-RA, transcript variant A (smi21F), mRNA 
0   11  NM_138988.2  CG11405-RA (A3-3), mRNA 
0   11  NM_164405.1  CG4710-RB, transcript variant B (smi21F), mRNA 
0   NM_078496.2  CG3025-RA (mof), mRNA 
0   NM_176581.2  CG33204-RA (CG33204), mRNA 
0   11  NM_175965.1  CG11924-RC, transcript variant C (Cf2), mRNA 
0   11  NM_175963.1  CG11924-RD, transcript variant D (Cf2), mRNA 
0   11  NM_078750.2  CG11924-RA, transcript variant A (Cf2), mRNA 
0   11  NM_175964.1  CG11924-RB, transcript variant B (Cf2), mRNA 
0   NM_134562.2  CG1324-RA (CG1324), mRNA 
0   NM_079700.1  CG3723-RA (Dhc93AB), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.