National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3665Ra-8 
 Symbol Fas2  Full Name Fasciclin 2 
 CG No CG3665  Old CG No CG3665 
 Synonyms Fas2, FasII, Fas II, fasII, mAb 1D4, 1D4, mAb1D4, fas2, CT12301, FASII, FAS II, Ab 1D4, fas II, CG3665, mAB1D4, clone 1.60, FascII, fas-II, l(1)G0032, l(1)G0048, l(1)G0081, l(1)G0293, l(1)G0336, anon-EST:Liang-1.60, EG:EG0007.3, FAS2 
 Accession No (Link to NCBI) NM_080327.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTAATAGAACTGACCCGTGCG 
 Primer Seq. 3'
aatctagaggtaccTGCACCACATACTTGTCGTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTAATAGAAC TGACCCGTGC GCAGTCCCCC ATCCTGGAGA TTTATCCCAA ACAAGAAGTC 
0061 CAGCGCAAGC CAGTGGGCAA GCCCCTGATC CTCACCTGCC GGCCCACAGT TCCCGAGCCG 
0121 TCCCTGGTCG CCGATCTGCA ATGGAAGGAC AATCGGAACA ACACCATTCT GCCCAAGCCG 
0181 AATGGACGCA ACCAGCCGCC GATGTACACG GAAACGCTGC CCGGCGAAAG TTTGGCCCTG 
0241 ATGATTACCT CGCTGTCGGT GGAAATGGGC GGCAAGTACT ACTGCACCGC CTCCTATGCA 
0301 AATACGGAGA TCCTCGAGAA GGGCGTCACA ATTAAAACTT ACGTGGCCAT CACCTGGACA 
0361 AATGCCCCTG AGAATCAGTA CCCCACTCTT GGCCAAGACT ATGTGGTAAT GTGCGAGGTA 
0421 AAGGCCGATC CCAATCCAAC AATCGACTGG CTGCGCAACG GAGATCCGAT CCGCACGACC 
0481 AACGACAAGT ATGTGGTGCA  
 in silico PCR Fragment
0001 TTAATAGAAC TGACCCGTGC GCAGTCCCCC ATCCTGGAGA TTTATCCCAA ACAAGAAGTC 
0061 CAGCGCAAGC CAGTGGGCAA GCCCCTGATC CTCACCTGCC GGCCCACAGT TCCCGAGCCG 
0121 TCCCTGGTCG CCGATCTGCA ATGGAAGGAC AATCGGAACA ACACCATTCT GCCCAAGCCG 
0181 AATGGACGCA ACCAGCCGCC GATGTACACG GAAACGCTGC CCGGCGAAAG TTTGGCCCTG 
0241 ATGATTACCT CGCTGTCGGT GGAAATGGGC GGCAAGTACT ACTGCACCGC CTCCTATGCA 
0301 AATACGGAGA TCCTCGAGAA GGGCGTCACA ATTAAAACTT ACGTGGCCAT CACCTGGACA 
0361 AATGCCCCTG AGAATCAGTA CCCCACTCTT GGCCAAGACT ATGTGGTAAT GTGCGAGGTA 
0421 AAGGCCGATC CCAATCCAAC AATCGACTGG CTGCGCAACG GAGATCCGAT CCGCACGACC 
0481 AACGACAAGT ATGTGGTGCA  
 Assemble Data

3665Ra-8.IR full       1   TTAATAGAACTGACCCGTGCGCAGTCCCCCATCCTGGAGATTTATCCCAAACAAGAAGTC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3665Ra-8.in silico     1   TTAATAGAACTGACCCGTGCGCAGTCCCCCATCCTGGAGATTTATCCCAAACAAGAAGTC 60


3665Ra-8.IR full       61  CAGCGCAAGCCAGTGGGCAAGCCCCTGATCCTCACCTGCCGGCCCACAGTTCCCGAGCCG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3665Ra-8.in silico     61  CAGCGCAAGCCAGTGGGCAAGCCCCTGATCCTCACCTGCCGGCCCACAGTTCCCGAGCCG 120


3665Ra-8.IR full       121 TCCCTGGTCGCCGATCTGCAATGGAAGGACAATCGGAACAACACCATTCTGCCCAAGCCG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3665Ra-8.in silico     121 TCCCTGGTCGCCGATCTGCAATGGAAGGACAATCGGAACAACACCATTCTGCCCAAGCCG 180


3665Ra-8.IR full       181 AATGGACGCAACCAGCCGCCGATGTACACGGAAACGCTGCCCGGCGAAAGTTTGGCCCTG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3665Ra-8.in silico     181 AATGGACGCAACCAGCCGCCGATGTACACGGAAACGCTGCCCGGCGAAAGTTTGGCCCTG 240


3665Ra-8.IR full       241 ATGATTACCTCGCTGTCGGTGGAAATGGGCGGCAAGTACTACTGCACCGCCTCCTATGCA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3665Ra-8.in silico     241 ATGATTACCTCGCTGTCGGTGGAAATGGGCGGCAAGTACTACTGCACCGCCTCCTATGCA 300


3665Ra-8.IR full       301 AATACGGAGATCCTCGAGAAGGGCGTCACAATTAAAACTTACGTGGCCATCACCTGGACA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3665Ra-8.in silico     301 AATACGGAGATCCTCGAGAAGGGCGTCACAATTAAAACTTACGTGGCCATCACCTGGACA 360


3665Ra-8.IR full       361 AATGCCCCTGAGAATCAGTACCCCACTCTTGGCCAAGACTATGTGGTAATGTGCGAGGTA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3665Ra-8.in silico     361 AATGCCCCTGAGAATCAGTACCCCACTCTTGGCCAAGACTATGTGGTAATGTGCGAGGTA 420


3665Ra-8.IR full       421 AAGGCCGATCCCAATCCAACAATCGACTGGCTGCGCAACGGAGATCCGATCCGCACGACC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3665Ra-8.in silico     421 AAGGCCGATCCCAATCCAACAATCGACTGGCTGCGCAACGGAGATCCGATCCGCACGACC 480


3665Ra-8.IR full       481 AACGACAAGTATGTGGTGCA 500
                           ||||||||||||||||||||
3665Ra-8.in silico     481 AACGACAAGTATGTGGTGCA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080327.2  CG3665-RA, transcript variant A (Fas2), mRNA 
100   482  NM_167004.1  CG3665-RB, transcript variant B (Fas2), mRNA 
100   482  NM_167005.1  CG3665-RC, transcript variant C (Fas2), mRNA 
0   NM_206504.1  CG31190-RB, transcript variant B (CG31190), mRNA 
0   NM_169761.1  CG31190-RA, transcript variant A (CG31190), mRNA 
0   NM_136055.2  CG10376-RA (CG10376), mRNA 
0   11  NM_135151.2  CG9175-RA, transcript variant A (CG9175), mRNA 
0   11  NM_164681.1  CG9175-RB, transcript variant B (CG9175), mRNA 
0   NM_167492.1  CG32576-RA, transcript variant A (CG32576), mRNA 
0   NM_132882.2  CG3560-RA (CG3560), mRNA 
0   NM_140723.1  CG12229-RA (CG12229), mRNA 
0   NM_170488.1  CG1471-RB, transcript variant B (CDase), mRNA 
0   NM_170491.1  CG1471-RE, transcript variant E (CDase), mRNA 
0   NM_170489.1  CG1471-RC, transcript variant C (CDase), mRNA 
0   NM_170490.1  CG1471-RD, transcript variant D (CDase), mRNA 
0   NM_143540.1  CG1471-RA, transcript variant A (CDase), mRNA 
0   NM_142275.1  CG17929-RA (CG17929), mRNA 
0   NM_079822.2  CG1721-RA, transcript variant A (Pglym78), mRNA 
0   NM_001038986.1  CG1721-RC, transcript variant C (Pglym78), mRNA 
0   NM_001038987.1  CG1721-RB, transcript variant B (Pglym78), mRNA 
0   NM_001014559.1  CG18314-RC, transcript variant C (DopEcR), mRNA 
0   NM_001014560.1  CG18314-RB, transcript variant B (DopEcR), mRNA 
0   NM_139640.2  CG18314-RA, transcript variant A (DopEcR), mRNA 
0   NM_140567.2  CG6017-RA (CG6017), mRNA 
0   NM_141299.1  CG1427-RA, transcript variant A (CG1427), mRNA 
0   NM_206433.1  CG1427-RB, transcript variant B (CG1427), mRNA 
0   NM_131936.2  CG3556-RA (CG3556), mRNA 
0   NM_176462.1  CG31116-RD, transcript variant D (CG31116), mRNA 
0   NM_167347.1  CG4353-RB, transcript variant B (hep), mRNA 
0   NM_167346.1  CG4353-RA, transcript variant A (hep), mRNA 
100   482  NM_080327.2  CG3665-RA, transcript variant A (Fas2), mRNA 
100   482  NM_167004.1  CG3665-RB, transcript variant B (Fas2), mRNA 
100   482  NM_167005.1  CG3665-RC, transcript variant C (Fas2), mRNA 
0   NM_206504.1  CG31190-RB, transcript variant B (CG31190), mRNA 
0   NM_169761.1  CG31190-RA, transcript variant A (CG31190), mRNA 
0   NM_136055.2  CG10376-RA (CG10376), mRNA 
0   11  NM_135151.2  CG9175-RA, transcript variant A (CG9175), mRNA 
0   11  NM_164681.1  CG9175-RB, transcript variant B (CG9175), mRNA 
0   NM_167492.1  CG32576-RA, transcript variant A (CG32576), mRNA 
0   NM_132882.2  CG3560-RA (CG3560), mRNA 
0   NM_140723.1  CG12229-RA (CG12229), mRNA 
0   NM_170488.1  CG1471-RB, transcript variant B (CDase), mRNA 
0   NM_170491.1  CG1471-RE, transcript variant E (CDase), mRNA 
0   NM_170489.1  CG1471-RC, transcript variant C (CDase), mRNA 
0   NM_170490.1  CG1471-RD, transcript variant D (CDase), mRNA 
0   NM_143540.1  CG1471-RA, transcript variant A (CDase), mRNA 
0   NM_142275.1  CG17929-RA (CG17929), mRNA 
0   NM_079822.2  CG1721-RA, transcript variant A (Pglym78), mRNA 
0   NM_001038986.1  CG1721-RC, transcript variant C (Pglym78), mRNA 
0   NM_001038987.1  CG1721-RB, transcript variant B (Pglym78), mRNA 
0   NM_001014559.1  CG18314-RC, transcript variant C (DopEcR), mRNA 
0   NM_001014560.1  CG18314-RB, transcript variant B (DopEcR), mRNA 
0   NM_139640.2  CG18314-RA, transcript variant A (DopEcR), mRNA 
0   NM_140567.2  CG6017-RA (CG6017), mRNA 
0   NM_141299.1  CG1427-RA, transcript variant A (CG1427), mRNA 
0   NM_206433.1  CG1427-RB, transcript variant B (CG1427), mRNA 
0   NM_131936.2  CG3556-RA (CG3556), mRNA 
0   NM_176462.1  CG31116-RD, transcript variant D (CG31116), mRNA 
0   NM_167347.1  CG4353-RB, transcript variant B (hep), mRNA 
0   NM_167346.1  CG4353-RA, transcript variant A (hep), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.