National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3608R-2 
 Symbol CG3608  Full Name CG3608 
 CG No CG3608  Old CG No CG3608 
 Synonyms CG3608 
 Accession No (Link to NCBI) NM_138103.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yoon W, Hwang SH, Lee SH, Chung J.
Drosophila ADCK1 is critical for maintaining mitochondrial structures and functions in the muscle.
PLoS Genet. (2019) 15(5) e1008184 [ PubMed ID = 31125351 ] [ RRC reference ]

Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]

Álvarez-Fernández C, Tamirisa S, Prada F, Chernomoretz A, Podhajcer O, Blanco E, Martín-Blanco E.
Identification and functional analysis of healing regulators in Drosophila.
PLoS Genet. (2015) 11(2) e1004965 [ PubMed ID = 25647511 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGTTGCGTCGCGTTCTGGGCT 
 Primer Seq. 3'
aatctagaggtaccGAGGCGCGCCTTATGTACCTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGTTGCGTCg NGTTCTGGGC TACGGAgNAG TCGGCGCCGG ACTGGCCTCC GCCGGCTGGA 
0061 GCCTGCACAC CAACGACTAC GATCCCAACT CACTCGGAAT CGTCCGGCTG TCGCGATCCG 
0121 CCGCCGCCGT CGTGGACGTG GCACTCACCT ACAAGCGGGA ACTTTACTAC NAGGAATGGG 
0181 ATAAGGAGAC GCCCGAGTAC AAGGCGGAAA AGAGCCGGGT CCACAAGATA GCCGCCGAGA 
0241 AGCTACTTCA GCTGATCTGC ATAAACAAGG GTGTCTACAT CAAGGTGGGC CAGCACATAG 
0301 GGGCCTTGGA GTACNTGCTG CTACCCAAGG AGTTTGTGCA GACCATGAAG GTACTTCACT 
0361 CCGATgNGCC GCAAAACCCC ATTGAGGACC TGTATAAGGT AATCCGACAG GATCTGCACT 
0421 GCAATCCGGA AGAAATCTTC GACAGCTTCG AGAGGGAGcC GCTGGGAACT GCTTCCCTTG 
0481 CCCAGGTACA TAANGGCGCG NCTc 
 in silico PCR Fragment
0001 TGTTGCGTCG CGTTCTGGGC TACGGAGTAG TCGGCGCCGG ACTGGCCTCC GCCGGCTGGA 
0061 GCCTGCACAC CAACGACTAC GATCCCAACT CACTCGGAAT CGTCCGGCTG TCGCGATCCG 
0121 CCGCCGCCGT CGTGGACGTG GCACTCACCT ACAAGCGGGA ACTTTACTAC AAGGAATGGG 
0181 ATAAGGAGAC GCCCGAGTAC AAGGCGGAAA AGAGCCGGGT CCACAAGATA GCCGCCGAGA 
0241 AGCTACTTCA GCTGATCTGC ATAAACAAGG GTGTCTACAT CAAGGTGGGC CAGCACATAG 
0301 GGGCCTTGGA GTAC---CTG CTACCCAAGG AGTTTGTGCA GACCATGAAG GTACTTCACT 
0361 CCGATGCGCC GCAAAACCCC ATTGAGGACC TGTATAAGGT AATCCGACAG GATCTGCACT 
0421 GCAATCCGGA AGAAATCTTC GACAGCTTCG AGAGGGAGCC GCTGGGAACT GCTTCCCTTG 
0481 CCCAGGTACA TAA-GGCGCG CCTC 
 Assemble Data

3608R-2.IR_full       1   TGTTGCGTCGNGTTCTGGGCTACGGAGNAGTCGGCGCCGGACTGGCCTCCGCCGGCTGGA 60
                          |||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||
3608R-2.in silico     1   TGTTGCGTCGCGTTCTGGGCTACGGAGTAGTCGGCGCCGGACTGGCCTCCGCCGGCTGGA 60


3608R-2.IR_full       61  GCCTGCACACCAACGACTACGATCCCAACTCACTCGGAATCGTCCGGCTGTCGCGATCCG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3608R-2.in silico     61  GCCTGCACACCAACGACTACGATCCCAACTCACTCGGAATCGTCCGGCTGTCGCGATCCG 120


3608R-2.IR_full       121 CCGCCGCCGTCGTGGACGTGGCACTCACCTACAAGCGGGAACTTTACTACNAGGAATGGG 180
                          |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
3608R-2.in silico     121 CCGCCGCCGTCGTGGACGTGGCACTCACCTACAAGCGGGAACTTTACTACAAGGAATGGG 180


3608R-2.IR_full       181 ATAAGGAGACGCCCGAGTACAAGGCGGAAAAGAGCCGGGTCCACAAGATAGCCGCCGAGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3608R-2.in silico     181 ATAAGGAGACGCCCGAGTACAAGGCGGAAAAGAGCCGGGTCCACAAGATAGCCGCCGAGA 240


3608R-2.IR_full       241 AGCTACTTCAGCTGATCTGCATAAACAAGGGTGTCTACATCAAGGTGGGCCAGCACATAG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3608R-2.in silico     241 AGCTACTTCAGCTGATCTGCATAAACAAGGGTGTCTACATCAAGGTGGGCCAGCACATAG 300


3608R-2.IR_full       301 GGGCCTTGGAGTACNTGCTGCTACCCAAGGAGTTTGTGCAGACCATGAAGGTACTTCACT 360
                          ||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||
3608R-2.in silico     301 GGGCCTTGGAGTAC---CTGCTACCCAAGGAGTTTGTGCAGACCATGAAGGTACTTCACT 360


3608R-2.IR_full       361 CCGATGNGCCGCAAAACCCCATTGAGGACCTGTATAAGGTAATCCGACAGGATCTGCACT 420
                          |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
3608R-2.in silico     361 CCGATGCGCCGCAAAACCCCATTGAGGACCTGTATAAGGTAATCCGACAGGATCTGCACT 420


3608R-2.IR_full       421 GCAATCCGGAAGAAATCTTCGACAGCTTCGAGAGGGAGCCGCTGGGAACTGCTTCCCTTG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3608R-2.in silico     421 GCAATCCGGAAGAAATCTTCGACAGCTTCGAGAGGGAGCCGCTGGGAACTGCTTCCCTTG 480


3608R-2.IR_full       481 CCCAGGTACATAANGGCGCGNCTC 504
                          ||||||||||||| |||||| |||
3608R-2.in silico     481 CCCAGGTACATAA-GGCGCGCCTC 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_138103.2  CG3608-RA (CG3608), mRNA 
0   NM_140189.1  CG7616-RA (CG7616), mRNA 
0   NM_143141.2  CG4548-RB, transcript variant B (XNP), mRNA 
0   NM_170228.1  CG4548-RA, transcript variant A (XNP), mRNA 
0   NM_142374.2  CG5823-RA (CG5823), mRNA 
0   NM_176101.1  CG30492-RE, transcript variant E (CG30492), mRNA 
0   NM_176102.1  CG30492-RD, transcript variant D (CG30492), mRNA 
0   NR_001305.1  CG30492-RD, transcript variant D (CG30492), mRNA, mRNA 
0   NM_078505.2  CG3429-RA (swa), mRNA 
0   NM_133075.2  CG6461-RA (CG6461), mRNA 
0   NM_079504.3  CG1133-RA (opa), mRNA 
0   NM_176131.3  CG12052-RP, transcript variant P (lola), mRNA 
0   NM_135122.1  CG9029-RA (CG9029), mRNA 
0   NM_142255.2  CG4221-RA (CG4221), mRNA 
0   NM_140804.2  CG6874-RA, transcript variant A (l(3)neo26), mRNA 
0   NM_168777.1  CG6874-RB, transcript variant B (l(3)neo26), mRNA 
0   11  NM_079700.1  CG3723-RA (Dhc93AB), mRNA 
0   NM_142889.1  CG4374-RA (CG4374), mRNA 
0   NM_143450.1  CG18111-RA (Obp99a), mRNA 
0   NM_139590.2  CG1134-RA (CG1134), mRNA 
0   NM_132405.2  CG2887-RA (CG2887), mRNA 
0   NM_134728.1  CG4726-RA (CG4726), mRNA 
0   NM_142339.1  CG5169-RA (CG5169), mRNA 
0   18  NM_078656.3  CG9108-RA (RSG7), mRNA 
0   11  NM_001014454.1  CG33526-RA, transcript variant A (PNUTS), mRNA 
0   11  NM_001014455.1  CG33526-RB, transcript variant B (PNUTS), mRNA 
0   11  NM_001014452.1  CG33526-RC, transcript variant C (PNUTS), mRNA 
0   10  NM_137735.1  CG30394-RA, transcript variant A (CG30394), mRNA 
0   NM_080025.1  CG11387-RA, transcript variant A (ct), mRNA 
0   18  NM_135002.1  CG15635-RA (CG15635), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.