National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3608R-1 
 Symbol CG3608  Full Name CG3608 
 CG No CG3608  Old CG No CG3608 
 Synonyms CG3608 
 Accession No (Link to NCBI) NM_138103.2 
 Inserted Chr. lll 
 Insertional Mutation  2 lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Hasygar K, Hietakangas V.
p53- and ERK7-dependent ribosome surveillance response regulates Drosophila insulin-like peptide secretion.
PLoS Genet. (2014) 10(11) e1004764 [ PubMed ID = 25393288 ] [ RRC reference ]

Álvarez-Fernández C, Tamirisa S, Prada F, Chernomoretz A, Podhajcer O, Blanco E, Martín-Blanco E.
Identification and functional analysis of healing regulators in Drosophila.
PLoS Genet. (2015) 11(2) e1004965 [ PubMed ID = 25647511 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| silico     1   TGTTGCGTCGCGTTCTGGGCTACGGAGTAGTCGGCGCCGGACTGGCCTCCGCCGGCTGGA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCCTGCACACCAACGACTACGATCCCAACTCACTCGGAATCGTCCGGCTGTCGCGATCCG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| silico     121 CCGCCGCCGTCGTGGACGTGGCACTCACCTACAAGCGGGAACTTTACTACAAGGAATGGG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ATAAGGAGACGCCCGAGTACAAGGCGGAAAAGAGCCGGGTCCACAAGATAGCCGCCGAGA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AGCTACTTCAGCTGATCTGCATAAACAAGGGTGTCTACATCAAGGTGGGCCAGCACATAG 300

                          ||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||| silico     301 GGGCCTTGGAGTAC---CTGCTACCCAAGGAGTTTGTGCAGACCATGAAGGTACTTCACT 360

                          |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CCGATGCGCCGCAAAACCCCATTGAGGACCTGTATAAGGTAATCCGACAGGATCTGCACT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GCAATCCGGAAGAAATCTTCGACAGCTTCGAGAGGGAGCCGCTGGGAACTGCTTCCCTTG 480

3608R-1.IR_full       481 CCCAGGTACATAANGGCGCGNCTC 504
                          ||||||||||||| |||||| ||| silico     481 CCCAGGTACATAA-GGCGCGCCTC 504

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_138103.2  CG3608-RA (CG3608), mRNA 
0   NM_140189.1  CG7616-RA (CG7616), mRNA 
0   NM_143141.2  CG4548-RB, transcript variant B (XNP), mRNA 
0   NM_170228.1  CG4548-RA, transcript variant A (XNP), mRNA 
0   NM_142374.2  CG5823-RA (CG5823), mRNA 
0   NM_176101.1  CG30492-RE, transcript variant E (CG30492), mRNA 
0   NM_176102.1  CG30492-RD, transcript variant D (CG30492), mRNA 
0   NR_001305.1  CG30492-RD, transcript variant D (CG30492), mRNA, mRNA 
0   NM_078505.2  CG3429-RA (swa), mRNA 
0   NM_133075.2  CG6461-RA (CG6461), mRNA 
0   NM_079504.3  CG1133-RA (opa), mRNA 
0   NM_176131.3  CG12052-RP, transcript variant P (lola), mRNA 
0   NM_135122.1  CG9029-RA (CG9029), mRNA 
0   NM_142255.2  CG4221-RA (CG4221), mRNA 
0   NM_140804.2  CG6874-RA, transcript variant A (l(3)neo26), mRNA 
0   NM_168777.1  CG6874-RB, transcript variant B (l(3)neo26), mRNA 
0   11  NM_079700.1  CG3723-RA (Dhc93AB), mRNA 
0   NM_142889.1  CG4374-RA (CG4374), mRNA 
0   NM_143450.1  CG18111-RA (Obp99a), mRNA 
0   NM_139590.2  CG1134-RA (CG1134), mRNA 
0   NM_132405.2  CG2887-RA (CG2887), mRNA 
0   NM_134728.1  CG4726-RA (CG4726), mRNA 
0   NM_142339.1  CG5169-RA (CG5169), mRNA 
0   18  NM_078656.3  CG9108-RA (RSG7), mRNA 
0   11  NM_001014454.1  CG33526-RA, transcript variant A (PNUTS), mRNA 
0   11  NM_001014455.1  CG33526-RB, transcript variant B (PNUTS), mRNA 
0   11  NM_001014452.1  CG33526-RC, transcript variant C (PNUTS), mRNA 
0   10  NM_137735.1  CG30394-RA, transcript variant A (CG30394), mRNA 
0   NM_080025.1  CG11387-RA, transcript variant A (ct), mRNA 
0   18  NM_135002.1  CG15635-RA (CG15635), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.