National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3496R-3 
 Symbol vir  Full Name virilizer 
 CG No CG3496  Old CG No CG3496 
 Synonyms CG3496, vir 
 Accession No (Link to NCBI) NM_080161.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTCGCATGAGGAAGTGACGGA 
 Primer Seq. 3'
aatctagaggtaccCTTTGTGAGCGGTCAGCAGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTCGCATGAG GAAGTGACGG ACATCAATTT GGATTTGGTG CAGTTTCCCA AGNCCGGTCT 
0061 TCATCACACA GGTGGGGGAT CATTCCTCTC GGCGCCCGAG TCCAGGCAGA CTTTCCCGGC 
0121 GGCGTTcGCC TGGGCGCCAC CAACCCCTCC AAGTTCGACC TGGAGTTCTT CGTCAATGAC 
0181 CTGGGAATGC CGGCTGCGTC GGCATTCGAG AACCTCGGCC TGCTGCGTTA CAACCAGAAC 
0241 GACTGCATTC ACTTGGATTG CTCGCAGGAG AAGATCNTCA CCGACGGTCT GGTgcTGCGC 
0301 GGCTGGTACA GCACCATCAC ACTGGCCATC TACGGCATTN TCACCAANTC GGTGACCGAG 
0361 CCAATCGCCA GTCCAACGCT GCCCTGCGAg cNCGTGGGCC CGGAGATANC CNACCTGAGT 
0421 GGCGAGGTGC TCCTCCAGGA GGATGTGCTG AAAGACGAGT GGCAGGAGCC GATGCAGGCC 
0481 GAACTGCTGA CCGCTNACAA NG 
 in silico PCR Fragment
0001 CTCGCATGAG GAAGTGACGG ACATCAATTT GGATTTGGTG CAGTTTCCCA AG-CCGGTCT 
0061 TCATCACACA GGT-GCGGAT CATTCCTCTC GGCGCCCGAG TCCAGGCAGA CTTTCCCGGC 
0121 GGCGTTCGCC TGGGCGCCAC CAACCCCTCC AAGTTCGACC TGGAGTTCTT CGTCAATGAC 
0181 CTGGGAATGC CGGCTGCGTC GGCATTCGAG AACCTCGGCC TGCTGCGTTA CAACCAGAAC 
0241 GACTGCATTC ACTTGGATTG CTCGCAGGAG AAGATCGTCA CCGACGGTCT GGTGCTGCGC 
0301 GGCTGGTACA GCACCATCAC ACTGGCCATC TACGGCATTT TCACCAACTC GGTGACCGAG 
0361 CCAATCGCCA GTCCAACGCT GCCCTGCGAG CCCGTGGGCC CGGAGATAGC CAACCTGAGT 
0421 GGCGAGGTGC TCCTCCAGGA GGATGTGCTG AAAGACGAGT GGCAGGAGCC GATGCAGGCC 
0481 GAACTGCTGA CCGCTCACAA AG 
 Assemble Data

3496R-3.IR_full       1   CTCGCATGAGGAAGTGACGGACATCAATTTGGATTTGGTGCAGTTTCCCAAGNCCGGTCT 60
                          |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
3496R-3.in silico     1   CTCGCATGAGGAAGTGACGGACATCAATTTGGATTTGGTGCAGTTTCCCAAG-CCGGTCT 60


3496R-3.IR_full       61  TCATCACACAGGTGGGGGATCATTCCTCTCGGCGCCCGAGTCCAGGCAGACTTTCCCGGC 120
                          ||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||
3496R-3.in silico     61  TCATCACACAGGT-GCGGATCATTCCTCTCGGCGCCCGAGTCCAGGCAGACTTTCCCGGC 120


3496R-3.IR_full       121 GGCGTTCGCCTGGGCGCCACCAACCCCTCCAAGTTCGACCTGGAGTTCTTCGTCAATGAC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3496R-3.in silico     121 GGCGTTCGCCTGGGCGCCACCAACCCCTCCAAGTTCGACCTGGAGTTCTTCGTCAATGAC 180


3496R-3.IR_full       181 CTGGGAATGCCGGCTGCGTCGGCATTCGAGAACCTCGGCCTGCTGCGTTACAACCAGAAC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3496R-3.in silico     181 CTGGGAATGCCGGCTGCGTCGGCATTCGAGAACCTCGGCCTGCTGCGTTACAACCAGAAC 240


3496R-3.IR_full       241 GACTGCATTCACTTGGATTGCTCGCAGGAGAAGATCNTCACCGACGGTCTGGTGCTGCGC 300
                          |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
3496R-3.in silico     241 GACTGCATTCACTTGGATTGCTCGCAGGAGAAGATCGTCACCGACGGTCTGGTGCTGCGC 300


3496R-3.IR_full       301 GGCTGGTACAGCACCATCACACTGGCCATCTACGGCATTNTCACCAANTCGGTGACCGAG 360
                          ||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||
3496R-3.in silico     301 GGCTGGTACAGCACCATCACACTGGCCATCTACGGCATTTTCACCAACTCGGTGACCGAG 360


3496R-3.IR_full       361 CCAATCGCCAGTCCAACGCTGCCCTGCGAGCNCGTGGGCCCGGAGATANCCNACCTGAGT 420
                          ||||||||||||||||||||||||||||||| |||||||||||||||| || ||||||||
3496R-3.in silico     361 CCAATCGCCAGTCCAACGCTGCCCTGCGAGCCCGTGGGCCCGGAGATAGCCAACCTGAGT 420


3496R-3.IR_full       421 GGCGAGGTGCTCCTCCAGGAGGATGTGCTGAAAGACGAGTGGCAGGAGCCGATGCAGGCC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3496R-3.in silico     421 GGCGAGGTGCTCCTCCAGGAGGATGTGCTGAAAGACGAGTGGCAGGAGCCGATGCAGGCC 480


3496R-3.IR_full       481 GAACTGCTGACCGCTNACAANG 502
                          ||||||||||||||| |||| |
3496R-3.in silico     481 GAACTGCTGACCGCTCACAAAG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080161.1  CG3496-RA (vir), mRNA 
0   NM_169693.1  CG4261-RA (Hel89B), mRNA 
0   NM_132334.2  CG17252-RA (BCL7-like), mRNA 
0   NM_166910.1  CG14815-RA, transcript variant A (CG14815), mRNA 
0   NM_130593.3  CG14815-RB, transcript variant B (CG14815), mRNA 
0   NM_079224.3  CG10037-RA (vvl), mRNA 
0   NM_079316.2  CG4237-RA (Gap69C), mRNA 
0   NM_132797.2  CG9198-RA, transcript variant A (shtd), mRNA 
0   NM_170258.2  CG32474-RA (dys), mRNA 
0   NM_132047.2  CG16721-RA (CG16721), mRNA 
0   NM_142027.2  CG9799-RA (CG9799), mRNA 
0   NM_137909.2  CG9882-RA (Art7), mRNA 
0   NM_142248.2  CG31183-RA (CG31183), mRNA 
0   NM_165479.1  CG15845-RA, transcript variant A (Adf1), mRNA 
0   NM_206028.1  CG15845-RC, transcript variant C (Adf1), mRNA 
0   NM_165480.1  CG15845-RB, transcript variant B (Adf1), mRNA 
0   NM_079000.2  CG3879-RA (Mdr49), mRNA 
0   NM_135170.3  CG9497-RA (CG9497), mRNA 
0   NM_057413.3  CG2210-RA (awd), mRNA 
0   NM_134937.2  CG3246-RA (CG3246), mRNA 
0   NM_057462.3  CG1916-RA (Wnt2), mRNA 
0   NM_058091.3  CG3152-RA (Trap1), mRNA 
0   NM_136692.1  CG12140-RA (CG12140), mRNA 
0   NM_132084.2  CG12219-RA (CG12219), mRNA 
0   NM_132991.1  CG12432-RA (CG12432), mRNA 
0   NM_170099.1  CG5854-RB, transcript variant B (CG5854), mRNA 
0   NM_142939.1  CG5854-RA, transcript variant A (CG5854), mRNA 
0   NM_079486.3  CG7478-RA (Act79B), mRNA 
0   NM_079684.3  CG4510-RA (Surf6), mRNA 
0   10  NM_135176.2  CG9506-RA (slam), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
DB
DC
++ 
DM
VM
 
VB
 
Caspase-3 signal
N
DB
++ 
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.