National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3448R-2 
 Symbol CG3448  Full Name CG3448 
 CG No CG3448  Old CG No CG3448 
 Synonyms CG3448 
 Accession No (Link to NCBI) NM_140059.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Álvarez-Fernández C, Tamirisa S, Prada F, Chernomoretz A, Podhajcer O, Blanco E, Martín-Blanco E.
Identification and functional analysis of healing regulators in Drosophila.
PLoS Genet. (2015) 11(2) e1004965 [ PubMed ID = 25647511 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTCAACGCTCTCAGCTCTCAC 
 Primer Seq. 3'
aatctagaggtaccGAGAAGTTCCTCCTCCTTCAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTCAACGCTC TCAGCTCTCA CATAGTCAAA TAGACGTAAA GCCGTTTATT TATGTCCGAA 
0061 GCAAATGGAT GGACGACGAC GTGGAGTTTG ACATCCTGAC CACTTCTGAC AATCAAAACT 
0121 ACCGGTCAAG TGTAAAATAC GATGAGTTTC GAAGTGGAGC CAGTGAATTG GAACAGGACT 
0181 ACGATGCTTT CTTTGCGGAG TGCAAAAGTG CTCTAACTAC GCACATGGGA CTCCAAGGAT 
0241 TTGATTATGA AATATCCATG GAAGATGTCG AAAAACCAGC CTTCAAAGTG TACAAATGCG 
0301 AAGGATACGA AACGCTGTAC TTGGATGTTC CGCTTAGAAA AGTCTCCAAC TGCTACCAGT 
0361 TGCTGGATGC AGCCATCGAA GCTGGTCAGC AGAAGCCACA AGCAGCTCCA GCCACCGAAT 
0421 CCGACGCCCA GACAACCGCA TCCCTGGCTG AATATGAAAA GTATGTGAGG GACAGCAAGC 
0481 TGAAGGAGGA GGAACTTCTC  
 in silico PCR Fragment
0001 TTCAACGCTC TCAGCTCTCA CATAGTCAAA TAGACGTAAA GCCGTTTATT TATGTCCGAA 
0061 GCAAATGGAT GGACGACGAC GTGGAGTTTG ACATCCTGAC CACTTCTGAC AATCAAAACT 
0121 ACCGGTCAAT TGTAAAATAC GATGAGTTTC GAAGTGGAGC CAGTGAATTG GAACAGGCCT 
0181 ACGATGCTTT CTTTGCGGAG TGCAAAAGTG CCGTAACTAC GCACATGGGA CTCCAAGGAT 
0241 TTGATTATGA AATATCCATG GAAGATGTCG AAAAACCAGC GTTCAAAGTG TACAAATGCG 
0301 AAGGATACGA AACGCTGTAC TTGGATGTTC CGCTTAGAAA AGTCTCCAAC TGCTACCAGA 
0361 TGCTGGATGC AGCCATCGAA GCTGGTCAGC AGAAGCCACA AGCAGCTCCA GCCACCGAAT 
0421 CCGACGCCCA GACAACCGCA TCCCTGGCTG AATATGAAAA GTATGTGAGG GACAGCAAGC 
0481 TGAAGGAGGA GGAACTTCTC  
 Assemble Data

3448R-2.IR_full       1   TTCAACGCTCTCAGCTCTCACATAGTCAAATAGACGTAAAGCCGTTTATTTATGTCCGAA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3448R-2.in silico     1   TTCAACGCTCTCAGCTCTCACATAGTCAAATAGACGTAAAGCCGTTTATTTATGTCCGAA 60


3448R-2.IR_full       61  GCAAATGGATGGACGACGACGTGGAGTTTGACATCCTGACCACTTCTGACAATCAAAACT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3448R-2.in silico     61  GCAAATGGATGGACGACGACGTGGAGTTTGACATCCTGACCACTTCTGACAATCAAAACT 120


3448R-2.IR_full       121 ACCGGTCAAGTGTAAAATACGATGAGTTTCGAAGTGGAGCCAGTGAATTGGAACAGGACT 180
                          ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||
3448R-2.in silico     121 ACCGGTCAATTGTAAAATACGATGAGTTTCGAAGTGGAGCCAGTGAATTGGAACAGGCCT 180


3448R-2.IR_full       181 ACGATGCTTTCTTTGCGGAGTGCAAAAGTGCTCTAACTACGCACATGGGACTCCAAGGAT 240
                          |||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||
3448R-2.in silico     181 ACGATGCTTTCTTTGCGGAGTGCAAAAGTGCCGTAACTACGCACATGGGACTCCAAGGAT 240


3448R-2.IR_full       241 TTGATTATGAAATATCCATGGAAGATGTCGAAAAACCAGCCTTCAAAGTGTACAAATGCG 300
                          |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
3448R-2.in silico     241 TTGATTATGAAATATCCATGGAAGATGTCGAAAAACCAGCGTTCAAAGTGTACAAATGCG 300


3448R-2.IR_full       301 AAGGATACGAAACGCTGTACTTGGATGTTCCGCTTAGAAAAGTCTCCAACTGCTACCAGT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
3448R-2.in silico     301 AAGGATACGAAACGCTGTACTTGGATGTTCCGCTTAGAAAAGTCTCCAACTGCTACCAGA 360


3448R-2.IR_full       361 TGCTGGATGCAGCCATCGAAGCTGGTCAGCAGAAGCCACAAGCAGCTCCAGCCACCGAAT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3448R-2.in silico     361 TGCTGGATGCAGCCATCGAAGCTGGTCAGCAGAAGCCACAAGCAGCTCCAGCCACCGAAT 420


3448R-2.IR_full       421 CCGACGCCCAGACAACCGCATCCCTGGCTGAATATGAAAAGTATGTGAGGGACAGCAAGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3448R-2.in silico     421 CCGACGCCCAGACAACCGCATCCCTGGCTGAATATGAAAAGTATGTGAGGGACAGCAAGC 480


3448R-2.IR_full       481 TGAAGGAGGAGGAACTTCTC 500
                          ||||||||||||||||||||
3448R-2.in silico     481 TGAAGGAGGAGGAACTTCTC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140059.2  CG3448-RB (CG3448), mRNA 
0.2   NM_130508.1  CG14635-RA (CG14635), mRNA 
0   NM_001038882.1  CG4622-RB, transcript variant B (CG4622), mRNA 
0   NM_138085.2  CG4622-RA, transcript variant A (CG4622), mRNA 
0   13  NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   NM_166129.2  CG18255-RD, transcript variant D (Strn-Mlck), mRNA 
0   NM_139743.2  CG10483-RA (CG10483), mRNA 
0   NM_079895.2  CG11064-RA (RfaBp), mRNA 
0   NM_142593.1  CG4459-RA (CG4459), mRNA 
0   NM_135281.1  CG6630-RA (CG6630), mRNA 
0   NM_137846.2  CG17807-RA (CG17807), mRNA 
0   NM_165215.1  CG31803-RA (CG31803), mRNA 
0   NM_167705.1  CG1695-RB, transcript variant B (CG1695), mRNA 
0   NM_134550.1  CG1695-RA, transcript variant A (CG1695), mRNA 
0   NM_170307.1  CG6265-RB, transcript variant B (Nep5), mRNA 
0   NM_143270.2  CG6265-RA, transcript variant A (Nep5), mRNA 
0   NM_001014642.1  CG33518-RA (mun), mRNA 
0   NM_176694.1  CG3126-RB, transcript variant B (C3G), mRNA 
0   NM_132122.2  CG3126-RA, transcript variant A (C3G), mRNA 
0   NM_169392.1  CG14704-RC, transcript variant C (PGRP-LB), mRNA 
0   NM_169393.1  CG14704-RB, transcript variant B (PGRP-LB), mRNA 
0   NM_141822.2  CG14704-RA, transcript variant A (PGRP-LB), mRNA 
0   NM_132093.2  CG3367-RA (CG3367), mRNA 
0   NM_134843.2  CG3515-RA (CG3515), mRNA 
0   NM_140433.1  CG13484-RA (CG13484), mRNA 
0   NM_137238.2  CG8403-RA (SP2353), mRNA 
0   NM_141142.1  CG6914-RA (CG6914), mRNA 
0   NM_080303.2  CG3707-RA, transcript variant A (wapl), mRNA 
0   NM_166931.1  CG3707-RB, transcript variant B (wapl), mRNA 
0   NM_078666.2  CG8146-RA (Socs16D), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.