National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3437Ra-2 
 Symbol CG3437  Full Name CG3437 
 CG No CG3437  Old CG No CG3437 
 Synonyms CG3437 
 Accession No (Link to NCBI) NM_140061.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTAGAGAACCCACCGTTCGTGA 
 Primer Seq. 3'
aatctagaggtaccCAGCTTCGACTCCACAAAGCG 
 Predicted Fragment Size
496 
 IR fragment full Seq
0001 TAGAGAACCC ACCGTTCGTG AGCTTGAGCG GCGCTGCTTC ATAGAGAGCC TGTATCAATT 
0061 GTTTAATCTG GGTTCTCCCG AGTCCTTTAC ACGCGCCCTC ACCTTACCGG ACTATGTGCG 
0121 TCGGGATGCG ACGTTTAAGC TTTGTTTTGG GATCTGTTTG GCCTTCCAAC AGGGCAATTT 
0181 GTATAGAGTG CTCATGGGTG TGCCACAATT GCCGCATATT CTGTGCGCGG TAGTGCCGCC 
0241 AAGTTGCAGG TGATAAGGAG GNAAGGAGGA GTTTGTTGCA GATTTTCACG CATGCCTACA 
0301 ACAACAAACA GCTTACGGTG CCGGTTCCTT ACTTGTTGCG TTTACTGTTG TTCGATGGGC 
0361 CAACAGGATT GCAGGACCAA TGTCGGCATT ATAATATATC CTTAACAGCG GATAGGAAGG 
0421 CGGTGCAATT TAATAAGACT GATTTTAACC ACAATGCAGA GGTATTTACA CCCCAACACG 
0481 AGCGCTTTGT GGAGTCGAAG CTG 
 in silico PCR Fragment
0001 TAGAGAACCC ACCGTTCGTG AGCTTGAGCG GCGCTGCTTC ATAGAGAGCC TGTATCAATT 
0061 GTTTAATCTG GGTTCTCCCG AGTCCTTTAC ACGCGCCCTC ACCTTACCGG ACTATGTGCG 
0121 TCGGGATGCG ACGTTTAAGC TTTGTTTTGG GATCTGTTTG GCCTTCCAAC AGGGCAATTT 
0181 GTATAGAGTG CTCATGGGTG TGCCACAATT GCCGCATATT CTGTGCGCGG TAGCTGCCGC 
0241 CAAGTTGCAG GTGATAAGGA GGAGTTTGTT GCAGATTTTC ACGCATGCCT ACAACAACAA 
0301 ACAGCTTACG GTGCCGGTTC CTTACTTGTT GCGTTTACTG TTGTTCGATG GGCCAACAGG 
0361 ATTGCAGGAC CAATGTCGGC ATTATAATAT ATCCTTAACA GCGGATAGGA AGGCGGTGCA 
0421 ATTTAATAAG ACTGATTTTA ACCACAATGC AGAGGTATTT ACACCCCAAC ACGAGCGCTT 
0481 TGTGGAGTCG AAGCTG 
 Assemble Data

3437Ra-2.IR full       1   TAGAGAACCCACCGTTCGTGAGCTTGAGCGGCGCTGCTTCATAGAGAGCCTGTATCAATT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3437Ra-2.in silico     1   TAGAGAACCCACCGTTCGTGAGCTTGAGCGGCGCTGCTTCATAGAGAGCCTGTATCAATT 60


3437Ra-2.IR full       61  GTTTAATCTGGGTTCTCCCGAGTCCTTTACACGCGCCCTCACCTTACCGGACTATGTGCG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3437Ra-2.in silico     61  GTTTAATCTGGGTTCTCCCGAGTCCTTTACACGCGCCCTCACCTTACCGGACTATGTGCG 120


3437Ra-2.IR full       121 TCGGGATGCGACGTTTAAGCTTTGTTTTGGGATCTGTTTGGCCTTCCAACAGGGCAATTT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3437Ra-2.in silico     121 TCGGGATGCGACGTTTAAGCTTTGTTTTGGGATCTGTTTGGCCTTCCAACAGGGCAATTT 180


3437Ra-2.IR full       181 GTATAGAGTGCTCATGGGTGTGCCACAATTGCCGCATATTCTGTGCGCGGTAG-TGCCGC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
3437Ra-2.in silico     181 GTATAGAGTGCTCATGGGTGTGCCACAATTGCCGCATATTCTGTGCGCGGTAGCTGCCGC 240


3437Ra-2.IR full       241 CAAGTTGCAGGTGATAAGGAGGNAAGGAGGAGTTTGTTGCAGATTTTCACGCATGCCTAC 300
                           |||||||||||||||||||        |||||||||||||||||||||||||||||||||
3437Ra-2.in silico     241 CAAGTTGCAGGTGATAAGG--------AGGAGTTTGTTGCAGATTTTCACGCATGCCTAC 300


3437Ra-2.IR full       301 AACAACAAACAGCTTACGGTGCCGGTTCCTTACTTGTTGCGTTTACTGTTGTTCGATGGG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3437Ra-2.in silico     301 AACAACAAACAGCTTACGGTGCCGGTTCCTTACTTGTTGCGTTTACTGTTGTTCGATGGG 360


3437Ra-2.IR full       361 CCAACAGGATTGCAGGACCAATGTCGGCATTATAATATATCCTTAACAGCGGATAGGAAG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3437Ra-2.in silico     361 CCAACAGGATTGCAGGACCAATGTCGGCATTATAATATATCCTTAACAGCGGATAGGAAG 420


3437Ra-2.IR full       421 GCGGTGCAATTTAATAAGACTGATTTTAACCACAATGCAGAGGTATTTACACCCCAACAC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3437Ra-2.in silico     421 GCGGTGCAATTTAATAAGACTGATTTTAACCACAATGCAGAGGTATTTACACCCCAACAC 480


3437Ra-2.IR full       481 GAGCGCTTTGTGGAGTCGAAGCTG 504
                           ||||||||||||||||||||||||
3437Ra-2.in silico     481 GAGCGCTTTGTGGAGTCGAAGCTG 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   478  NM_140061.1  CG3437-RA (CG3437), mRNA 
0   NM_140051.2  CG3689-RB, transcript variant B (CG3689), mRNA 
0   NM_167288.1  CG32666-RB, transcript variant B (CG32666), mRNA 
0   NM_206688.1  CG32666-RA, transcript variant A (CG32666), mRNA 
0   NM_169601.1  CG7425-RA (eff), mRNA 
0   NM_057278.3  CG7727-RA (Appl), mRNA 
0   NM_142028.1  CG14375-RA (CG14375), mRNA 
0   NM_141444.1  CG10061-RA (l(3)s2214), mRNA 
0   NM_164762.1  CG7052-RC, transcript variant C (TepII), mRNA 
0   NM_144404.1  CG18778-RA (CG18778), mRNA 
0   NM_166975.1  CG10804-RA, transcript variant A (CG10804), mRNA 
0   NM_130705.1  CG10804-RB, transcript variant B (CG10804), mRNA 
0   NM_140377.1  CG17687-RA (CG17687), mRNA 
0   NM_132834.1  CG8198-RA (l(1)G0136), mRNA 
0   13  NM_001032052.1  CG33715-RE, transcript variant E (Msp-300), mRNA 
0   NM_164442.1  CG31664-RA (CG31664), mRNA 
0   NM_001043192.1  CG1106-RI, transcript variant I (Gel), mRNA 
0   NM_057638.3  CG14472-RA (poe), mRNA 
0   NM_139796.2  CG10121-RB, transcript variant B (SP1173), mRNA 
0   NM_168176.1  CG10121-RA, transcript variant A (SP1173), mRNA 
0   NM_168177.2  CG10121-RC, transcript variant C (SP1173), mRNA 
0   NM_168178.1  CG10121-RD, transcript variant D (SP1173), mRNA 
0   NM_164793.1  CG31607-RA (CG31607), mRNA 
0   NM_080091.2  CG14993-RA (Faa), mRNA 
0   NM_132343.2  CG3002-RB (Gga), mRNA 
0   NM_135336.2  CG7466-RA (CG7466), mRNA 
0   NM_078905.2  CG12847-RA (Tsp42Ec), mRNA 
0   11  NM_166173.2  CG6262-RC, transcript variant C (CG6262), mRNA 
0   11  NM_137279.3  CG6262-RA, transcript variant A (CG6262), mRNA 
0   11  NM_166172.3  CG6262-RB, transcript variant B (CG6262), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.