National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3429R-3 
 Symbol swaPsi  Full Name swallow pseudogene 
 CG No CR32747  Old CG No CG3429 
 Synonyms unnamed, CG3429, CR32747, swaPsi 
 Accession No (Link to NCBI) NM_078505.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CGAGAGTTTTCCGACGGACGAGCTGTTTGACCAGCTGAACAATTTGAGTAGCAGTGGCGC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CAGGAATACCTGGTTCGCGGAGCACCATAAGCCCGCAGTCTTCGAGCGGGATACAGCGCC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ATTTTTGGAGATCTGCTACGCGGATCCAGACTTTGATGCGGATGGGGATGTGGCCAACAA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GAGCGCCAAGACATGCGTAAGCGATCCCGTGGGTCGTGATCAGGAGGATGAGGACGACTA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGATGAGGATGTCGATGGCGATGATCATAAACTGGGTTGCGAGAAGGCTCCATTGGGCAG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGGGCGCTCCAGCAAGGCGGTCTCTTACCAGGACATCCATTCGGCCTACACGAAGCGCCG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CTTCCAGCACGTGACCAGCAAGGTGGGCCAGTACATAGCGGAGATCCAGGCGCAGGACCA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AAAGAGACGCAATGTGAAGTTCGCCGGATTCCAGCGAGTGAACTCTATGCCGGAGAGTCT 480

3429R-3.IR_full       481 AACGCCCACATTGCAGCAGG 500
                          |||||||||||||||||||| silico     481 AACGCCCACATTGCAGCAGG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078505.2  CG3429-RA (swa), mRNA 
12.03   58  41  19  27  NR_001305.1  CG3429-RA (swa), mRNA, mRNA 
0.41   NM_139725.2  CG5249-RA (Blimp-1), mRNA 
0.2   NM_206278.1  CG5406-RC, transcript variant C (sif), mRNA 
0.2   NM_079908.2  CG5406-RA, transcript variant A (sif), mRNA 
0.2   NM_168126.1  CG5406-RB, transcript variant B (sif), mRNA 
0.2   17  NM_058124.2  CG5772-RA (Sur), mRNA 
0.2   NM_131936.2  CG3556-RA (CG3556), mRNA 
0   10  NM_166984.1  CG13316-RC, transcript variant C (Mnt), mRNA 
0   10  NM_166983.1  CG13316-RA, transcript variant A (Mnt), mRNA 
0   10  NM_130715.2  CG13316-RB, transcript variant B (Mnt), mRNA 
0   11  NM_131944.1  CG3546-RA (CG3546), mRNA 
0   36  NM_079967.4  CG6611-RA, transcript variant A (ect), mRNA 
0   36  NM_168400.1  CG6611-RB, transcript variant B (ect), mRNA 
0   36  NM_168401.1  CG6611-RC, transcript variant C (ect), mRNA 
0   13  11  NM_135112.1  CG11030-RA (CG11030), mRNA 
0   NM_138103.2  CG3608-RA (CG3608), mRNA 
0   NM_169222.2  CG31462-RA (CG31462), mRNA 
0   NM_132438.1  CG11203-RA (CG11203), mRNA 
0   NM_132787.1  CG15032-RA (CG15032), mRNA 
0   NM_079986.2  CG7238-RA (sip1), mRNA 
0   NM_143714.2  CG4746-RA (mab-2), mRNA 
0   NM_137748.2  CG10080-RA (CG10080), mRNA 
0   12  13  NM_136942.2  CG8545-RA (CG8545), mRNA 
0   11  24  NM_176498.1  CG9297-RA, transcript variant A (CG9297), mRNA 
0   20  NM_176497.1  CG9297-RB, transcript variant B (CG9297), mRNA 
0   15  NM_141281.2  CG2087-RA (PEK), mRNA 
0   NM_134530.2  CG9576-RA (CG9576), mRNA 
0   NM_132823.1  CG15646-RA (CG15646), mRNA 
0   NM_079608.2  CG6148-RB, transcript variant B (Past1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.