National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3429R-2 
 Symbol swaPsi  Full Name swallow pseudogene 
 CG No CR32747  Old CG No CG3429 
 Synonyms unnamed, CG3429, CR32747, swaPsi 
 Accession No (Link to NCBI) NM_078505.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGAGAGTTTTCCGACGGACGA 
 Primer Seq. 3'
aatctagaggtaccCCTGCTGCAATGTGGGCGTTA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGAGAGTTTT CCGACGGACG AGCTGTTTGA CCAGCTGAAC AATTTGAGTA GCAGTGGCGC 
0061 CAGGAATACC TGGTTCGCGG AGCACCATAA GCCCGCAGTC TTCGAGCGGG ATACAGCGCC 
0121 ATTTTTGGAG ATCTGCTACG CGGATCCAGA CTTTGATGCG GATGGGGATG TGGCCAACAA 
0181 GAGCGCCAAG ACATGCGTAA GCGATCCCGT GGGTCGTGAT CAGGAGGATG AGGACGACTA 
0241 TGATGAGGAT GTCGATGGCG ATGATCATAA ACTGGGTTGC GAGAAGGCTC CATTGGGCAG 
0301 CGGGCGCTCC AGCAAGGCGG TCTCTTACCA GGACATCCAT TCGGCCTACA CGAAGCGCCG 
0361 CTTCCAGCAC GTGACCAGCA AGGTGGGCCA GTACATAGCG GAGATCCAGG CGCAGGACCA 
0421 AAAGAGACGC AATGTGAAGT TCGCCGGATT CCAGCGAGTG AACTCTATGC CGGAGAGTCT 
0481 AACGCCCACA TTGCAGCAGG  
 in silico PCR Fragment
0001 CGAGAGTTTT CCGACGGACG AGCTGTTTGA CCAGCTGAAC AATTTGAGTA GCAGTGGCGC 
0061 CAGGAATACC TGGTTCGCGG AGCACCATAA GCCCGCAGTC TTCGAGCGGG ATACAGCGCC 
0121 ATTTTTGGAG ATCTGCTACG CGGATCCAGA CTTTGATGCG GATGGGGATG TGGCCAACAA 
0181 GAGCGCCAAG ACATGCGTAA GCGATCCCGT GGGTCGTGAT CAGGAGGATG AGGACGACTA 
0241 TGATGAGGAT GTCGATGGCG ATGATCATAA ACTGGGTTGC GAGAAGGCTC CATTGGGCAG 
0301 CGGGCGCTCC AGCAAGGCGG TCTCTTACCA GGACATCCAT TCGGCCTACA CGAAGCGCCG 
0361 CTTCCAGCAC GTGACCAGCA AGGTGGGCCA GTACATAGCG GAGATCCAGG CGCAGGACCA 
0421 AAAGAGACGC AATGTGAAGT TCGCCGGATT CCAGCGAGTG AACTCTATGC CGGAGAGTCT 
0481 AACGCCCACA TTGCAGCAGG  
 Assemble Data

3429R-2.IR_full       1   CGAGAGTTTTCCGACGGACGAGCTGTTTGACCAGCTGAACAATTTGAGTAGCAGTGGCGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3429R-2.in silico     1   CGAGAGTTTTCCGACGGACGAGCTGTTTGACCAGCTGAACAATTTGAGTAGCAGTGGCGC 60


3429R-2.IR_full       61  CAGGAATACCTGGTTCGCGGAGCACCATAAGCCCGCAGTCTTCGAGCGGGATACAGCGCC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3429R-2.in silico     61  CAGGAATACCTGGTTCGCGGAGCACCATAAGCCCGCAGTCTTCGAGCGGGATACAGCGCC 120


3429R-2.IR_full       121 ATTTTTGGAGATCTGCTACGCGGATCCAGACTTTGATGCGGATGGGGATGTGGCCAACAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3429R-2.in silico     121 ATTTTTGGAGATCTGCTACGCGGATCCAGACTTTGATGCGGATGGGGATGTGGCCAACAA 180


3429R-2.IR_full       181 GAGCGCCAAGACATGCGTAAGCGATCCCGTGGGTCGTGATCAGGAGGATGAGGACGACTA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3429R-2.in silico     181 GAGCGCCAAGACATGCGTAAGCGATCCCGTGGGTCGTGATCAGGAGGATGAGGACGACTA 240


3429R-2.IR_full       241 TGATGAGGATGTCGATGGCGATGATCATAAACTGGGTTGCGAGAAGGCTCCATTGGGCAG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3429R-2.in silico     241 TGATGAGGATGTCGATGGCGATGATCATAAACTGGGTTGCGAGAAGGCTCCATTGGGCAG 300


3429R-2.IR_full       301 CGGGCGCTCCAGCAAGGCGGTCTCTTACCAGGACATCCATTCGGCCTACACGAAGCGCCG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3429R-2.in silico     301 CGGGCGCTCCAGCAAGGCGGTCTCTTACCAGGACATCCATTCGGCCTACACGAAGCGCCG 360


3429R-2.IR_full       361 CTTCCAGCACGTGACCAGCAAGGTGGGCCAGTACATAGCGGAGATCCAGGCGCAGGACCA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3429R-2.in silico     361 CTTCCAGCACGTGACCAGCAAGGTGGGCCAGTACATAGCGGAGATCCAGGCGCAGGACCA 420


3429R-2.IR_full       421 AAAGAGACGCAATGTGAAGTTCGCCGGATTCCAGCGAGTGAACTCTATGCCGGAGAGTCT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3429R-2.in silico     421 AAAGAGACGCAATGTGAAGTTCGCCGGATTCCAGCGAGTGAACTCTATGCCGGAGAGTCT 480


3429R-2.IR_full       481 AACGCCCACATTGCAGCAGG 500
                          ||||||||||||||||||||
3429R-2.in silico     481 AACGCCCACATTGCAGCAGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078505.2  CG3429-RA (swa), mRNA 
12.03   58  41  19  27  NR_001305.1  CG3429-RA (swa), mRNA, mRNA 
0.41   NM_139725.2  CG5249-RA (Blimp-1), mRNA 
0.2   NM_206278.1  CG5406-RC, transcript variant C (sif), mRNA 
0.2   NM_079908.2  CG5406-RA, transcript variant A (sif), mRNA 
0.2   NM_168126.1  CG5406-RB, transcript variant B (sif), mRNA 
0.2   17  NM_058124.2  CG5772-RA (Sur), mRNA 
0.2   NM_131936.2  CG3556-RA (CG3556), mRNA 
0   10  NM_166984.1  CG13316-RC, transcript variant C (Mnt), mRNA 
0   10  NM_166983.1  CG13316-RA, transcript variant A (Mnt), mRNA 
0   10  NM_130715.2  CG13316-RB, transcript variant B (Mnt), mRNA 
0   11  NM_131944.1  CG3546-RA (CG3546), mRNA 
0   36  NM_079967.4  CG6611-RA, transcript variant A (ect), mRNA 
0   36  NM_168400.1  CG6611-RB, transcript variant B (ect), mRNA 
0   36  NM_168401.1  CG6611-RC, transcript variant C (ect), mRNA 
0   13  11  NM_135112.1  CG11030-RA (CG11030), mRNA 
0   NM_138103.2  CG3608-RA (CG3608), mRNA 
0   NM_169222.2  CG31462-RA (CG31462), mRNA 
0   NM_132438.1  CG11203-RA (CG11203), mRNA 
0   NM_132787.1  CG15032-RA (CG15032), mRNA 
0   NM_079986.2  CG7238-RA (sip1), mRNA 
0   NM_143714.2  CG4746-RA (mab-2), mRNA 
0   NM_137748.2  CG10080-RA (CG10080), mRNA 
0   12  13  NM_136942.2  CG8545-RA (CG8545), mRNA 
0   11  24  NM_176498.1  CG9297-RA, transcript variant A (CG9297), mRNA 
0   20  NM_176497.1  CG9297-RB, transcript variant B (CG9297), mRNA 
0   15  NM_141281.2  CG2087-RA (PEK), mRNA 
0   NM_134530.2  CG9576-RA (CG9576), mRNA 
0   NM_132823.1  CG15646-RA (CG15646), mRNA 
0   NM_079608.2  CG6148-RB, transcript variant B (Past1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.