National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3420R-1 
 Symbol CG3420  Full Name CG3420 
 CG No CG3420  Old CG No CG3420 
 Synonyms BcDNA:RE40412, CG3420 
 Accession No (Link to NCBI) NM_136390.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGATACTAAGACGGAACCTGGG 
 Primer Seq. 3'
aatctagaggtaccTTTGACGGCGCTCTGGATGTG 
 Predicted Fragment Size
400 
 IR fragment full Seq
0001 NATACTAAGA CGGAACCTGG GGGCATCCTG GTTGCTCAAG GCATGCTACA GTTCCAGCGC 
0061 AAAACCGGTG GACTCGGCCA AAACAATTCA CCAGTAACCT GCTCGAGGAT AAGCAAACGG 
0121 CCGTTCTGCA AAAGGAGAAC GGTACGNATC TTCGACAAGC GCCCCTTCAA GATCCACCTG 
0181 GACAAAGATA AAACATACAG CTGGTGCCTG TGCGGCAAGT CCAAGTCTCA GCCCCTCTGC 
0241 GATGGAATGC ACAAGAACGA GTTCCTGAAG ATCAAGCAGA GGCCCATTCG GTTCAAGGTG 
0301 GAGAAGTCGG GAGACTACTG GCTCTGCAAC TGCAAACAGA CCACCCACAG ACCCTTCTGT 
0361 GACGGCACCC ACAAGCAGCC ACACATCCAG AGCGCCGTCA AA 
 in silico PCR Fragment
0001 GATACTAAGA CGGAACCTGG GGGCATCCTG GTTGCTCAAG GCATGCTACA GTTCCAGCGC 
0061 AAAACCGGTG GACTCGGCCA AAACAATTC- CCAGTAACCT GCTCGAGGAT AAGCAAACGG 
0121 CCGTTCTGCA AAAGGAGAAC GGTACG-ATC TTCGACAAGC GCCCCTTCAA GATCCACCTG 
0181 GACAAAGATA AAACATACAG CTGGTGCCTG TGCGGCAAGT CCAAGTCTCA GCCCCTCTGC 
0241 GATGGAATGC ACAAGAACGA GTTCCTGAAG ATCAAGCAGA GGCCCATTCG GTTCAAGGTG 
0301 GAGAAGTCGG GAGACTACTG GCTCTGCAAC TGCAAACAGA CCACCCACAG ACCCTTCTGT 
0361 GACGGCACCC ACAAGCAGCC ACACATCCAG AGCGCCGTCA AA 
 Assemble Data

3420R-1.IR_full        1   ATACTAAGACGGAACCTGGGGGCATCCTGGTTGCTCAAGGCATGCTACAGTTCCAGCGC 59
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3420R-1.in silico      1   ATACTAAGACGGAACCTGGGGGCATCCTGGTTGCTCAAGGCATGCTACAGTTCCAGCGC 59


3420R-1.IR_full       61  AAAACCGGTGGACTCGGCCAAAACAATTCACCAGTAACCTGCTCGAGGATAAGCAAACGG 119
                          ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
3420R-1.in silico     61  AAAACCGGTGGACTCGGCCAAAACAATTC-CCAGTAACCTGCTCGAGGATAAGCAAACGG 119


3420R-1.IR_full       121 CCGTTCTGCAAAAGGAGAACGGTACGNATCTTCGACAAGCGCCCCTTCAAGATCCACCTG 179
                          |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
3420R-1.in silico     121 CCGTTCTGCAAAAGGAGAACGGTACG-ATCTTCGACAAGCGCCCCTTCAAGATCCACCTG 179


3420R-1.IR_full       181 GACAAAGATAAAACATACAGCTGGTGCCTGTGCGGCAAGTCCAAGTCTCAGCCCCTCTGC 239
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3420R-1.in silico     181 GACAAAGATAAAACATACAGCTGGTGCCTGTGCGGCAAGTCCAAGTCTCAGCCCCTCTGC 239


3420R-1.IR_full       241 GATGGAATGCACAAGAACGAGTTCCTGAAGATCAAGCAGAGGCCCATTCGGTTCAAGGTG 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3420R-1.in silico     241 GATGGAATGCACAAGAACGAGTTCCTGAAGATCAAGCAGAGGCCCATTCGGTTCAAGGTG 299


3420R-1.IR_full       301 GAGAAGTCGGGAGACTACTGGCTCTGCAACTGCAAACAGACCACCCACAGACCCTTCTGT 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3420R-1.in silico     301 GAGAAGTCGGGAGACTACTGGCTCTGCAACTGCAAACAGACCACCCACAGACCCTTCTGT 359


3420R-1.IR_full       361 GACGGCACCCACAAGCAGCCACACATCCAGAGCGCCGTCAAA 401
                          ||||||||||||||||||||||||||||||||||||||||||
3420R-1.in silico     361 GACGGCACCCACAAGCAGCCACACATCCAGAGCGCCGTCAAA 401

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   382  NM_136390.2  CG3420-RA (CG3420), mRNA 
0.52   NM_079293.2  CG8091-RA (Nc), mRNA 
0   NM_001014700.1  CG11049-RE, transcript variant E (sv), mRNA 
0   NM_079894.3  CG11049-RA, transcript variant A (sv), mRNA 
0   NM_001014697.1  CG11049-RH, transcript variant H (sv), mRNA 
0   NM_001014699.1  CG11049-RF, transcript variant F (sv), mRNA 
0   NM_001014701.1  CG11049-RD, transcript variant D (sv), mRNA 
0   NM_166822.3  CG11049-RC, transcript variant C (sv), mRNA 
0   NM_001014698.1  CG11049-RG, transcript variant G (sv), mRNA 
0   NM_137653.2  CG11175-RA (CG11175), mRNA 
0   NM_140738.2  CG7542-RA (CG7542), mRNA 
0   NM_001038953.1  CG10045-RB, transcript variant B (GstD1), mRNA 
0   NM_079602.3  CG10045-RA, transcript variant A (GstD1), mRNA 
0   NM_079032.2  CG18250-RA, transcript variant A (Dg), mRNA 
0   NM_141520.2  CG9630-RA (CG9630), mRNA 
0   NM_140996.2  CG4289-RA (CG4289), mRNA 
0   NM_141351.2  CG11459-RA (CG11459), mRNA 
0   NM_164565.1  CG3399-RC, transcript variant C (capu), mRNA 
0   NM_164566.1  CG3399-RD, transcript variant D (capu), mRNA 
0   NM_141790.2  CG6666-RA (CG6666), mRNA 
0   NM_164567.1  CG3399-RB, transcript variant B (capu), mRNA 
0   NM_057618.2  CG3399-RA, transcript variant A (capu), mRNA 
0   NM_057865.3  CG3324-RA (Pkg21D), mRNA 
0   NM_136634.2  CG1975-RA (Rep2), mRNA 
0   NM_131941.2  CG11436-RA (CG11436), mRNA 
0   NM_136777.2  CG30015-RB, transcript variant B (CG30015), mRNA 
0   NM_165802.1  CG30015-RA, transcript variant A (CG30015), mRNA 
0   NM_136636.3  CG13739-RA (CG13739), mRNA 
0   NM_168487.1  CG32096-RB, transcript variant B (rols), mRNA 
0   NM_140285.2  CG32096-RD, transcript variant D (rols), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.