National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3386R-3 
 Symbol CG3386  Full Name CG3386 
 CG No CG3386  Old CG No CG3386 
 Synonyms CG3386 
 Accession No (Link to NCBI) NM_138205.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCTGCACTGCCAGATCGGTT 
 Primer Seq. 3'
aatctagaggtaccCGGACTGGTAGTTGAAAGCGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCTGCACTG CCAGATCGGT TTAGTGCGGG CAAGCGGCAG TTCTGGCGCG AGTTTCTGGC 
0061 CCTTTATCAG GGAATGCCGG AGCTGTGGGA CGTCCACCAC CTCAATTACC GGAACAAGGA 
0121 GCTGCGAAAC CGGGCGTACG AGTTGCTGGA GAGGAAACTA CGGGAGATAC AGCCGAACGC 
0181 TACGCGCACA GAAGTCGGCA GGCGCATCAA CATATTTCGC ACCAATTACA GGCGGGAGCA 
0241 GATGCGAATC CTCAAGCAGA AGGAGCTGGG GCTGCACTCC GATCTNNGTA ANCCGACGCT 
0301 CTGGTTCTAC GACTACATGG GATTTCTCCT CACCCAGGAG ACCTTCCAGC ACAGGACCAG 
0361 AAAAGGTCGG GGCGGCAGAC AGAAGCAAGA TTTTCGCAGG GAAAAGGATG ACAAATACCC 
0421 CTTGAAAAAT CCAGATCTCA ACACGGAAAG CGTTTGTGAT TGGCCGATCA AGGATGATAA 
0481 CGCTTTCAAC TACCAGTCCG  
 in silico PCR Fragment
0001 AGCTGCACTG CCAGATCGGT TTAGTGCGGG CAAACGGCAG TTCTGGCGCG AGTTTCTGGC 
0061 CCTTTATCAG GGAATGCCGG AGCTGTGGGA CGTCCACCAC CTCAATTACC GGAACAAGGA 
0121 GCTGCGAAAC CGGGCGTATG AGTTGCTGGA GAGGAAACTA CGGGAGATAC AGCCGAACGC 
0181 TACGCGCACA GAAGTCGGCA GGCGCATCAA CATATTTCGC ACCAATTACA GGCGGGAGCA 
0241 GATGCGAATC CTCAAGCAGA AGGAGCTGGG GCTGCACTCC GATCTCTGTA AGCCGACGCT 
0301 CTGGTTCTAC GACTACATGG GATTTCTCCT CACCCAGGAG ACCTTCCAGC ACAGGACCAG 
0361 AAAAGGTCGG GGCGGCAGAC AGAAGCAAGA TTTTCGCAGG GAAAAGGATG ACAAATACCC 
0421 CTTGAAAAAT CCAGATCTCA ACACGGAAAG CGTTTGTGAT TGGCCGATCA AGGATGATAA 
0481 CGCTTTCAAC TACCAGTCCG  
 Assemble Data

3386R-3.IR_full       1   AGCTGCACTGCCAGATCGGTTTAGTGCGGGCAAGCGGCAGTTCTGGCGCGAGTTTCTGGC 60
                          ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
3386R-3.in silico     1   AGCTGCACTGCCAGATCGGTTTAGTGCGGGCAAACGGCAGTTCTGGCGCGAGTTTCTGGC 60


3386R-3.IR_full       61  CCTTTATCAGGGAATGCCGGAGCTGTGGGACGTCCACCACCTCAATTACCGGAACAAGGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3386R-3.in silico     61  CCTTTATCAGGGAATGCCGGAGCTGTGGGACGTCCACCACCTCAATTACCGGAACAAGGA 120


3386R-3.IR_full       121 GCTGCGAAACCGGGCGTACGAGTTGCTGGAGAGGAAACTACGGGAGATACAGCCGAACGC 180
                          |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
3386R-3.in silico     121 GCTGCGAAACCGGGCGTATGAGTTGCTGGAGAGGAAACTACGGGAGATACAGCCGAACGC 180


3386R-3.IR_full       181 TACGCGCACAGAAGTCGGCAGGCGCATCAACATATTTCGCACCAATTACAGGCGGGAGCA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3386R-3.in silico     181 TACGCGCACAGAAGTCGGCAGGCGCATCAACATATTTCGCACCAATTACAGGCGGGAGCA 240


3386R-3.IR_full       241 GATGCGAATCCTCAAGCAGAAGGAGCTGGGGCTGCACTCCGATCTNNGTAANCCGACGCT 300
                          |||||||||||||||||||||||||||||||||||||||||||||  |||| ||||||||
3386R-3.in silico     241 GATGCGAATCCTCAAGCAGAAGGAGCTGGGGCTGCACTCCGATCTCTGTAAGCCGACGCT 300


3386R-3.IR_full       301 CTGGTTCTACGACTACATGGGATTTCTCCTCACCCAGGAGACCTTCCAGCACAGGACCAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3386R-3.in silico     301 CTGGTTCTACGACTACATGGGATTTCTCCTCACCCAGGAGACCTTCCAGCACAGGACCAG 360


3386R-3.IR_full       361 AAAAGGTCGGGGCGGCAGACAGAAGCAAGATTTTCGCAGGGAAAAGGATGACAAATACCC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3386R-3.in silico     361 AAAAGGTCGGGGCGGCAGACAGAAGCAAGATTTTCGCAGGGAAAAGGATGACAAATACCC 420


3386R-3.IR_full       421 CTTGAAAAATCCAGATCTCAACACGGAAAGCGTTTGTGATTGGCCGATCAAGGATGATAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3386R-3.in silico     421 CTTGAAAAATCCAGATCTCAACACGGAAAGCGTTTGTGATTGGCCGATCAAGGATGATAA 480


3386R-3.IR_full       481 CGCTTTCAACTACCAGTCCG 500
                          ||||||||||||||||||||
3386R-3.in silico     481 CGCTTTCAACTACCAGTCCG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_138205.1  CG3386-RA (CG3386), mRNA 
0.2   NM_139603.2  CG14996-RB (Chd64), mRNA 
0   NM_132274.2  CG1785-RA (CG1785), mRNA 
0   NM_144201.2  CG15212-RA (CG15212), mRNA 
0   NM_143219.1  CG5432-RA (CG5432), mRNA 
0   NM_133124.1  CG7502-RA (CG7502), mRNA 
0   NM_001043097.1  CG9854-RC, transcript variant C (hrg), mRNA 
0   NM_080529.2  CG9854-RA, transcript variant A (hrg), mRNA 
0   NM_143011.1  CG6631-RA, transcript variant A (CG6631), mRNA 
0   NM_170148.1  CG6631-RB, transcript variant B (CG6631), mRNA 
0   NM_130478.2  CG2995-RA (CG2995), mRNA 
0   NM_143105.2  CG11857-RA (CG11857), mRNA 
0   NM_057797.2  CG10387-RA (tos), mRNA 
0   NM_143446.2  CG1907-RA (CG1907), mRNA 
0   NM_169483.1  CG7340-RC, transcript variant C (granny-smith), mRNA 
0   NM_141983.2  CG7340-RB, transcript variant B (granny-smith), mRNA 
0   NM_137151.2  CG10212-RA (SMC2), mRNA 
0   NM_169482.1  CG7340-RA, transcript variant A (granny-smith), mRNA 
0   NM_001014478.1  CG33529-RA, transcript variant A (Rapgap1), mRNA 
0   NM_001014479.1  CG33529-RB, transcript variant B (Rapgap1), mRNA 
0   NM_136940.1  CG8830-RA, transcript variant A (CG8830), mRNA 
0   NM_165900.1  CG8830-RB, transcript variant B (CG8830), mRNA 
0   10  NM_165018.1  CG6167-RB, transcript variant B (PICK1), mRNA 
0   10  NM_135738.2  CG6167-RA, transcript variant A (PICK1), mRNA 
0   NM_143309.1  CG13972-RA (CG13972), mRNA 
0   NM_137732.2  CG9754-RA (CG9754), mRNA 
0   NM_170549.1  CG31204-RA (CG31204), mRNA 
0   NM_001015499.1  CG40444-PA.3 (CG40444), mRNA 
0   NM_079282.1  CG3322-RA (LanB2), mRNA 
0   NM_167521.2  CG32575-RA, transcript variant A (hang), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.