National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3386R-1 
 Symbol CG3386  Full Name CG3386 
 CG No CG3386  Old CG No CG3386 
 Synonyms CG3386 
 Accession No (Link to NCBI) NM_138205.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| silico     1   AGCTGCACTGCCAGATCGGTTTAGTGCGGGCAAACGGCAGTTCTGGCGCGAGTTTCTGGC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CCTTTATCAGGGAATGCCGGAGCTGTGGGACGTCCACCACCTCAATTACCGGAACAAGGA 120

                          |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| silico     121 GCTGCGAAACCGGGCGTATGAGTTGCTGGAGAGGAAACTACGGGAGATACAGCCGAACGC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TACGCGCACAGAAGTCGGCAGGCGCATCAACATATTTCGCACCAATTACAGGCGGGAGCA 240

                          |||||||||||||||||||||||||||||||||||||||||||||  |||| |||||||| silico     241 GATGCGAATCCTCAAGCAGAAGGAGCTGGGGCTGCACTCCGATCTCTGTAAGCCGACGCT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CTGGTTCTACGACTACATGGGATTTCTCCTCACCCAGGAGACCTTCCAGCACAGGACCAG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AAAAGGTCGGGGCGGCAGACAGAAGCAAGATTTTCGCAGGGAAAAGGATGACAAATACCC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CTTGAAAAATCCAGATCTCAACACGGAAAGCGTTTGTGATTGGCCGATCAAGGATGATAA 480

3386R-1.IR_full       481 CGCTTTCAACTACCAGTCCG 500
                          |||||||||||||||||||| silico     481 CGCTTTCAACTACCAGTCCG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_138205.1  CG3386-RA (CG3386), mRNA 
0.2   NM_139603.2  CG14996-RB (Chd64), mRNA 
0   NM_132274.2  CG1785-RA (CG1785), mRNA 
0   NM_144201.2  CG15212-RA (CG15212), mRNA 
0   NM_143219.1  CG5432-RA (CG5432), mRNA 
0   NM_133124.1  CG7502-RA (CG7502), mRNA 
0   NM_001043097.1  CG9854-RC, transcript variant C (hrg), mRNA 
0   NM_080529.2  CG9854-RA, transcript variant A (hrg), mRNA 
0   NM_143011.1  CG6631-RA, transcript variant A (CG6631), mRNA 
0   NM_170148.1  CG6631-RB, transcript variant B (CG6631), mRNA 
0   NM_130478.2  CG2995-RA (CG2995), mRNA 
0   NM_143105.2  CG11857-RA (CG11857), mRNA 
0   NM_057797.2  CG10387-RA (tos), mRNA 
0   NM_143446.2  CG1907-RA (CG1907), mRNA 
0   NM_169483.1  CG7340-RC, transcript variant C (granny-smith), mRNA 
0   NM_141983.2  CG7340-RB, transcript variant B (granny-smith), mRNA 
0   NM_137151.2  CG10212-RA (SMC2), mRNA 
0   NM_169482.1  CG7340-RA, transcript variant A (granny-smith), mRNA 
0   NM_001014478.1  CG33529-RA, transcript variant A (Rapgap1), mRNA 
0   NM_001014479.1  CG33529-RB, transcript variant B (Rapgap1), mRNA 
0   NM_136940.1  CG8830-RA, transcript variant A (CG8830), mRNA 
0   NM_165900.1  CG8830-RB, transcript variant B (CG8830), mRNA 
0   10  NM_165018.1  CG6167-RB, transcript variant B (PICK1), mRNA 
0   10  NM_135738.2  CG6167-RA, transcript variant A (PICK1), mRNA 
0   NM_143309.1  CG13972-RA (CG13972), mRNA 
0   NM_137732.2  CG9754-RA (CG9754), mRNA 
0   NM_170549.1  CG31204-RA (CG31204), mRNA 
0   NM_001015499.1  CG40444-PA.3 (CG40444), mRNA 
0   NM_079282.1  CG3322-RA (LanB2), mRNA 
0   NM_167521.2  CG32575-RA, transcript variant A (hang), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.