National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3371R-2 
 Symbol CG3371  Full Name CG3371 
 CG No CG3371  Old CG No CG3371 
 Synonyms unnamed, EP3592, CG3371 
 Accession No (Link to NCBI) NM_138206.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Kamimura K, Koyama T, Habuchi H, Ueda R, Masu M, Kimata K, Nakato H.
Specific and flexible roles of heparan sulfate modifications in Drosophila FGF signaling.
J Cell Biol (2006) 174(6) 773-8 [ PubMed ID = 16966419 ] [ RRC reference ]

Kobayashi M, Michaut L, Ino A, Honjo K, Nakajima T, Maruyama Y, Mochizuki H, Ando M, Ghangrekar I, Takahashi K, Saigo K, Ueda R, Gehring WJ, Furukubo-Tokunaga K.
Differential microarray analysis of Drosophila mushroom body transcripts using chemical ablation.
Proc Natl Acad Sci U S A (2006) 103(39) 14417-22 [ PubMed ID = 16971484 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AGTTGCAGAGGGAGCTGAGGGTGGAGAAGCGCGTGGAGAGGGAGAAAAAGGAGCACAAGG 60

                          |||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| silico     61  AGGCCTCCAAGACGCAGGACAACAACAACAAGGCGAAGGCCACTGACACGGAGGTTCTCA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CACCAGCTCCTGCGCCTGCGCCTGCTCCACCAGCAGCACCCACTTCGACTGCATCACCCA 180

                          ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| silico     181 CACCCACTAGCACGCACACCCCCAGCCTGCCGGCCGCCGAG-AAGGTGGCCTTCGACAAT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CGCATCAAGCGCAAGAATGTCCTGGCCCTCAACGAAAAGGTTGCTGCTCTGCGGGAATAC 300

                          |||||||||||||||||||| ||||||||||||  ||||||||||||||||||||||||| silico     301 GATCGGCTGCCGGTTTATAA-GCACGTTGGCCGG-CTGTTCAACTGCAGCCCAGATCAGA 360

                          ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| silico     361 TCAAGCGGATCGTGCAGCAGCGCGCTGAGATTCTGAACGCGTGGGATCAGCGAACCCGCA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GGAGCCAGGACGCCAAGACCATGGAGACGAAGACCGTCAGGGTCTCGATGTTGGGCAAGG 480

3371R-2.IR_full       481 CCGTGTACGATTGGATACGCCGC 503
                          ||||||||||||||||||||||| silico     481 CCGTGTACGATTGGATACGCCGC 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_138206.1  CG3371-RA (CG3371), mRNA 
0.2   NM_079832.2  CG7887-RA (Takr99D), mRNA 
0   NM_078546.2  CG1780-RA, transcript variant A (Idgf4), mRNA 
0   NM_167207.1  CG1780-RB, transcript variant B (Idgf4), mRNA 
0   21  NM_078603.2  CG10952-RA, transcript variant A (eag), mRNA 
0   21  NM_001042810.1  CG10952-RB, transcript variant B (eag), mRNA 
0   NM_141653.2  CG16789-RA (CG16789), mRNA 
0   11  46  NM_136257.2  CG8677-RA (CG8677), mRNA 
0   11  44  NM_165363.1  CG31626-RB, transcript variant B (CG31626), mRNA 
0   11  44  NM_165362.1  CG31626-RA, transcript variant A (CG31626), mRNA 
0   11  13  NM_206407.1  CG32434-RA, transcript variant A (siz), mRNA 
0   11  12  NM_168881.1  CG32434-RB, transcript variant B (siz), mRNA 
0   11  11  NM_001043153.1  CG32434-RC, transcript variant C (siz), mRNA 
0   25  NM_132457.1  CG11122-RA (CG11122), mRNA 
0   10  NM_168767.1  CG32198-RB (CG32198), mRNA 
0   NM_143716.2  CG6754-RB (nbs), mRNA 
0   NM_001032403.1  CG7649-RB, transcript variant B (Neu3), mRNA 
0   NM_140328.4  CG10686-RA (tral), mRNA 
0   NM_001043221.1  CG7549-RC, transcript variant C (CG7549), mRNA 
0   NM_141518.1  CG7549-RA, transcript variant A (CG7549), mRNA 
0   NM_169212.1  CG7549-RB, transcript variant B (CG7549), mRNA 
0   NM_132897.1  CG4301-RA (CG4301), mRNA 
0   NM_137687.2  CG15651-RA (CG15651), mRNA 
0   11  14  NM_132412.1  CG9817-RA (CG9817), mRNA 
0   NM_078651.2  CG18582-RA (mbt), mRNA 
0   NM_166164.2  CG8048-RD, transcript variant D (Vha44), mRNA 
0   12  NM_169061.1  CG8048-RD, transcript variant D (Vha44), mRNA,4,5,-tris-phosphate receptor CG1063-RA, transcript variant A (Itp-r83A), mRNA 
0   12  NM_169060.1  CG8048-RD, transcript variant D (Vha44), mRNA,4,5,-tris-phosphate receptor CG1063-RA, transcript variant A (Itp-r83A), mRNA,4,5,-tris-phosphate receptor CG1063-RB, transcript variant B (Itp-r83A), mRNA 
0   NM_137075.2  CG18568-RA (CG18568), mRNA 
0   NM_140923.1  CG7335-RA (CG7335), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.