National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3371R-1 
 Symbol CG3371  Full Name CG3371 
 CG No CG3371  Old CG No CG3371 
 Synonyms unnamed, EP3592, CG3371 
 Accession No (Link to NCBI) NM_138206.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees male lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kobayashi M, Michaut L, Ino A, Honjo K, Nakajima T, Maruyama Y, Mochizuki H, Ando M, Ghangrekar I, Takahashi K, Saigo K, Ueda R, Gehring WJ, Furukubo-Tokunaga K.
Differential microarray analysis of Drosophila mushroom body transcripts using chemical ablation.
Proc. Natl. Acad. Sci. U.S.A. (2006) 103(39) 14417-22 [ PubMed ID = 16971484 ] [ RRC reference ]

Kamimura K, Koyama T, Habuchi H, Ueda R, Masu M, Kimata K, Nakato H.
Specific and flexible roles of heparan sulfate modifications in Drosophila FGF signaling.
J. Cell Biol. (2006) 174(6) 773-8 [ PubMed ID = 16966419 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGTTGCAGAGGGAGCTGAGGG 
 Primer Seq. 3'
aatctagaggtaccGCGGCGTATCCAATCGTACAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGTTGCAGAG GGAGCTGAGG GTGGAGAAGC GCGTGGAGAG GGAGAAAAAG GAGCACAAGG 
0061 AGGCCTCCAA GACGCAGGAC AACAACAACA AGGCGAAgNC CNCTGACACG GAGGTTCTCA 
0121 CACCAGCTCC TGCGCCTGCG cCTGCTCCAC CAGCAGCACC CACTTCGACT GCATCACCCA 
0181 CACCCACTAG CACGCACACC CCCAGCCTGC CGGCCGCCGA GNAAGGTGGC CTTCGACAAT 
0241 CGCATCAAGC GCAAGAATGT CCTGGCCCTC AACGAAAAGG TTGCTGCTCT GCGGGAATAC 
0301 GATCGGCTGC CGGTTTATAA GGCACGTTGG CCGATCTGTT CAACTGCAGC CCAGATCAGA 
0361 TCAAGCGGAT CGTGCAGCAG CGCGCGGAGA TTCTGAACGC GTGGGATCAG CGAACCCGCA 
0421 GGAGCCAGGA CGCCAAGACC ATGGAGACGA AGACCGTCAG GGTCTCGATG TTGGGCAAGG 
0481 CCGTGTACGA TTGGATACGC CGC 
 in silico PCR Fragment
0001 AGTTGCAGAG GGAGCTGAGG GTGGAGAAGC GCGTGGAGAG GGAGAAAAAG GAGCACAAGG 
0061 AGGCCTCCAA GACGCAGGAC AACAACAACA AGGCGAAGGC CACTGACACG GAGGTTCTCA 
0121 CACCAGCTCC TGCGCCTGCG CCTGCTCCAC CAGCAGCACC CACTTCGACT GCATCACCCA 
0181 CACCCACTAG CACGCACACC CCCAGCCTGC CGGCCGCCGA G-AAGGTGGC CTTCGACAAT 
0241 CGCATCAAGC GCAAGAATGT CCTGGCCCTC AACGAAAAGG TTGCTGCTCT GCGGGAATAC 
0301 GATCGGCTGC CGGTTTATAA -GCACGTTGG CCGG-CTGTT CAACTGCAGC CCAGATCAGA 
0361 TCAAGCGGAT CGTGCAGCAG CGCGCTGAGA TTCTGAACGC GTGGGATCAG CGAACCCGCA 
0421 GGAGCCAGGA CGCCAAGACC ATGGAGACGA AGACCGTCAG GGTCTCGATG TTGGGCAAGG 
0481 CCGTGTACGA TTGGATACGC CGC 
 Assemble Data

3371R-1.IR_full       1   AGTTGCAGAGGGAGCTGAGGGTGGAGAAGCGCGTGGAGAGGGAGAAAAAGGAGCACAAGG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3371R-1.in silico     1   AGTTGCAGAGGGAGCTGAGGGTGGAGAAGCGCGTGGAGAGGGAGAAAAAGGAGCACAAGG 60


3371R-1.IR_full       61  AGGCCTCCAAGACGCAGGACAACAACAACAAGGCGAAGNCCNCTGACACGGAGGTTCTCA 120
                          |||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||
3371R-1.in silico     61  AGGCCTCCAAGACGCAGGACAACAACAACAAGGCGAAGGCCACTGACACGGAGGTTCTCA 120


3371R-1.IR_full       121 CACCAGCTCCTGCGCCTGCGCCTGCTCCACCAGCAGCACCCACTTCGACTGCATCACCCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3371R-1.in silico     121 CACCAGCTCCTGCGCCTGCGCCTGCTCCACCAGCAGCACCCACTTCGACTGCATCACCCA 180


3371R-1.IR_full       181 CACCCACTAGCACGCACACCCCCAGCCTGCCGGCCGCCGAGNAAGGTGGCCTTCGACAAT 240
                          ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
3371R-1.in silico     181 CACCCACTAGCACGCACACCCCCAGCCTGCCGGCCGCCGAG-AAGGTGGCCTTCGACAAT 240


3371R-1.IR_full       241 CGCATCAAGCGCAAGAATGTCCTGGCCCTCAACGAAAAGGTTGCTGCTCTGCGGGAATAC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3371R-1.in silico     241 CGCATCAAGCGCAAGAATGTCCTGGCCCTCAACGAAAAGGTTGCTGCTCTGCGGGAATAC 300


3371R-1.IR_full       301 GATCGGCTGCCGGTTTATAAGGCACGTTGGCCGATCTGTTCAACTGCAGCCCAGATCAGA 360
                          |||||||||||||||||||| ||||||||||||  |||||||||||||||||||||||||
3371R-1.in silico     301 GATCGGCTGCCGGTTTATAA-GCACGTTGGCCGG-CTGTTCAACTGCAGCCCAGATCAGA 360


3371R-1.IR_full       361 TCAAGCGGATCGTGCAGCAGCGCGCGGAGATTCTGAACGCGTGGGATCAGCGAACCCGCA 420
                          ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
3371R-1.in silico     361 TCAAGCGGATCGTGCAGCAGCGCGCTGAGATTCTGAACGCGTGGGATCAGCGAACCCGCA 420


3371R-1.IR_full       421 GGAGCCAGGACGCCAAGACCATGGAGACGAAGACCGTCAGGGTCTCGATGTTGGGCAAGG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3371R-1.in silico     421 GGAGCCAGGACGCCAAGACCATGGAGACGAAGACCGTCAGGGTCTCGATGTTGGGCAAGG 480


3371R-1.IR_full       481 CCGTGTACGATTGGATACGCCGC 503
                          |||||||||||||||||||||||
3371R-1.in silico     481 CCGTGTACGATTGGATACGCCGC 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_138206.1  CG3371-RA (CG3371), mRNA 
0.2   NM_079832.2  CG7887-RA (Takr99D), mRNA 
0   NM_078546.2  CG1780-RA, transcript variant A (Idgf4), mRNA 
0   NM_167207.1  CG1780-RB, transcript variant B (Idgf4), mRNA 
0   21  NM_078603.2  CG10952-RA, transcript variant A (eag), mRNA 
0   21  NM_001042810.1  CG10952-RB, transcript variant B (eag), mRNA 
0   NM_141653.2  CG16789-RA (CG16789), mRNA 
0   11  46  NM_136257.2  CG8677-RA (CG8677), mRNA 
0   11  44  NM_165363.1  CG31626-RB, transcript variant B (CG31626), mRNA 
0   11  44  NM_165362.1  CG31626-RA, transcript variant A (CG31626), mRNA 
0   11  13  NM_206407.1  CG32434-RA, transcript variant A (siz), mRNA 
0   11  12  NM_168881.1  CG32434-RB, transcript variant B (siz), mRNA 
0   11  11  NM_001043153.1  CG32434-RC, transcript variant C (siz), mRNA 
0   25  NM_132457.1  CG11122-RA (CG11122), mRNA 
0   10  NM_168767.1  CG32198-RB (CG32198), mRNA 
0   NM_143716.2  CG6754-RB (nbs), mRNA 
0   NM_001032403.1  CG7649-RB, transcript variant B (Neu3), mRNA 
0   NM_140328.4  CG10686-RA (tral), mRNA 
0   NM_001043221.1  CG7549-RC, transcript variant C (CG7549), mRNA 
0   NM_141518.1  CG7549-RA, transcript variant A (CG7549), mRNA 
0   NM_169212.1  CG7549-RB, transcript variant B (CG7549), mRNA 
0   NM_132897.1  CG4301-RA (CG4301), mRNA 
0   NM_137687.2  CG15651-RA (CG15651), mRNA 
0   11  14  NM_132412.1  CG9817-RA (CG9817), mRNA 
0   NM_078651.2  CG18582-RA (mbt), mRNA 
0   NM_166164.2  CG8048-RD, transcript variant D (Vha44), mRNA 
0   12  NM_169061.1  CG8048-RD, transcript variant D (Vha44), mRNA,4,5,-tris-phosphate receptor CG1063-RA, transcript variant A (Itp-r83A), mRNA 
0   12  NM_169060.1  CG8048-RD, transcript variant D (Vha44), mRNA,4,5,-tris-phosphate receptor CG1063-RA, transcript variant A (Itp-r83A), mRNA,4,5,-tris-phosphate receptor CG1063-RB, transcript variant B (Itp-r83A), mRNA 
0   NM_137075.2  CG18568-RA (CG18568), mRNA 
0   NM_140923.1  CG7335-RA (CG7335), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.