National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3344R-4 
 Symbol CG3344  Full Name CG3344 
 CG No CG3344  Old CG No CG3344 
 Synonyms CG3344 
 Accession No (Link to NCBI) NM_138207.2 
 Inserted Chr. lll 
 Insertional Mutation  2 lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| silico     1   GCTGGACGCGCTATCATCGCACTTTTGGCCCTACTGGGATTTGCCGGCTTGGCTT-CCGT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TGACGCACGCAAGGGCTATGGACCCGGTGATCAGGATTGGGGATTTGTGGATGTCAGGAC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TGGCGCCCACATGTTCTACTGGCTGTACTACACCACCGCCAATGTCTCCAGTTACACGGA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCGTCCGCTGGCCATTTGGCTCCAAGGAGGTCCAGGTGCCTCCTCAACGGGATACGGAAA 240

                          ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| silico     241 CTTTGAGGAGTTGGGTCCCCTGAAGCTCGACGG-CAGCTACCGCGACTGGACTTGGGTGA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AGGACATGAACGTGATGTTCATCGACAATCCCGTGGGCAGTGGTTTCAGCTACGTGGACG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GATCTTCTTACTACACGACCAACAACAAGCAGATCGCCCTGGATCTCGTTGAGCTGATGA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AGGGCTTCTACACAAACCACCCGGAATTCAAGACTGTGCCGCTGCACATCTTCTGCGAGA 480

3344R-4.IR_full       481 GTTATGGCGGAAAGATGGCCCC 502
                          |||||||||||||||||||||| silico     481 GTTATGGCGGAAAGATGGCCCC 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_138207.2  CG3344-RA (CG3344), mRNA 
5.8   28  37  58  45  NM_167839.1  CG32483-RA (CG32483), mRNA 
0.2   NM_132997.2  CG8408-RA (CG8408), mRNA 
0   22  27  NM_135927.2  CG31821-RA (CG31821), mRNA 
0   11  NM_142579.2  CG4572-RB, transcript variant B (CG4572), mRNA 
0   11  NM_169879.1  CG4572-RC, transcript variant C (CG4572), mRNA 
0   11  NM_169878.1  CG4572-RA, transcript variant A (CG4572), mRNA 
0   NM_176360.1  CG32206-RC, transcript variant C (CG32206), mRNA 
0   NM_168794.2  CG32206-RB, transcript variant B (CG32206), mRNA 
0   15  NM_175960.3  CG33196-RB (dp), mRNA 
0   NM_057824.3  CG6601-RA (Rab6), mRNA 
0   NM_001032399.1  CG33955-RB (eys), mRNA 
0   NM_206081.1  CG18377-RD, transcript variant D (Cyp49a1), mRNA 
0   NM_136744.2  CG18377-RA, transcript variant A (Cyp49a1), mRNA 
0   NM_166685.1  CG3894-RB, transcript variant B (CG3894), mRNA 
0   NM_138119.5  CG3894-RA, transcript variant A (CG3894), mRNA 
0   NM_079959.2  CG4501-RA (bgm), mRNA 
0   NM_001043257.1  CG34157-RH, transcript variant H (Dys), mRNA 
0   NM_001043259.1  CG34157-RC, transcript variant C (Dys), mRNA 
0   NM_001043258.1  CG34157-RA, transcript variant A (Dys), mRNA 
0   NM_001043261.1  CG34157-RG, transcript variant G (Dys), mRNA 
0   NM_001043256.1  CG34157-RB, transcript variant B (Dys), mRNA 
0   NM_001043260.1  CG34157-RD, transcript variant D (Dys), mRNA 
0   NM_001043262.1  CG34157-RE, transcript variant E (Dys), mRNA 
0   NM_001043263.1  CG34157-RF, transcript variant F (Dys), mRNA 
0   NM_206236.1  CG15804-RB, transcript variant B (Dhc62B), mRNA 
0   NM_057737.2  CG15804-RA, transcript variant A (Dhc62B), mRNA 
0   NM_169610.1  CG6904-RA, transcript variant A (CG6904), mRNA 
0   NM_142165.2  CG6904-RB, transcript variant B (CG6904), mRNA 
0   NM_169611.1  CG6904-RC, transcript variant C (CG6904), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.