National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3344R-2 
 Symbol CG3344  Full Name CG3344 
 CG No CG3344  Old CG No CG3344 
 Synonyms CG3344 
 Accession No (Link to NCBI) NM_138207.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCTGGACGCGCTATCATCGCA 
 Primer Seq. 3'
aatctagaggtaccGGGGCCATCTTTCCGCCATAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCTGGACGCG CTATCATCGC ACTTTTGGCC CTACTGGGAT TTGCCGGCTT GGCTTCCCGT 
0061 TGACGCACGC AAGGGCTATG GACCCGGTGA TCAGGATTGG GGATTTGTGG ATGTCAGGAC 
0121 TGGCGCCCAC ATGTTCTACT GGCTGTACTA CACCACCGCC AATGTCTCCA GTTACACGGA 
0181 GCGTCCGCTG GCCATTTGGC TCCAAGGAGG TCCAGGTGCC TCCTCAACGG GATACGGAAA 
0241 CTTTGAGGAG TTGGGTCCCC TGAAGCTCGA CGGNCAGCTA CCGCGACTGG ACTTGGGTGA 
0301 AGGACATGAA CGTGATGTTC ATCGACAATC CCGTGGGCAG TGGTTTCAGC TACGTGGACG 
0361 GATCTTCTTA CTACACGACC AACAACAAGC AGATCGCCCT GGATCTCGTT GAGCTGATGA 
0421 AGGGCTTCTA CACAAACCAC CCGGAATTCA AGACTGTGCC GCTGCACATC TTCTGCGAGA 
0481 GTTATGGCGG AAAGATGGCC CC 
 in silico PCR Fragment
0001 GCTGGACGCG CTATCATCGC ACTTTTGGCC CTACTGGGAT TTGCCGGCTT GGCTT-CCGT 
0061 TGACGCACGC AAGGGCTATG GACCCGGTGA TCAGGATTGG GGATTTGTGG ATGTCAGGAC 
0121 TGGCGCCCAC ATGTTCTACT GGCTGTACTA CACCACCGCC AATGTCTCCA GTTACACGGA 
0181 GCGTCCGCTG GCCATTTGGC TCCAAGGAGG TCCAGGTGCC TCCTCAACGG GATACGGAAA 
0241 CTTTGAGGAG TTGGGTCCCC TGAAGCTCGA CGG-CAGCTA CCGCGACTGG ACTTGGGTGA 
0301 AGGACATGAA CGTGATGTTC ATCGACAATC CCGTGGGCAG TGGTTTCAGC TACGTGGACG 
0361 GATCTTCTTA CTACACGACC AACAACAAGC AGATCGCCCT GGATCTCGTT GAGCTGATGA 
0421 AGGGCTTCTA CACAAACCAC CCGGAATTCA AGACTGTGCC GCTGCACATC TTCTGCGAGA 
0481 GTTATGGCGG AAAGATGGCC CC 
 Assemble Data

3344R-2.IR_full       1   GCTGGACGCGCTATCATCGCACTTTTGGCCCTACTGGGATTTGCCGGCTTGGCTTCCCGT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
3344R-2.in silico     1   GCTGGACGCGCTATCATCGCACTTTTGGCCCTACTGGGATTTGCCGGCTTGGCTT-CCGT 60


3344R-2.IR_full       61  TGACGCACGCAAGGGCTATGGACCCGGTGATCAGGATTGGGGATTTGTGGATGTCAGGAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3344R-2.in silico     61  TGACGCACGCAAGGGCTATGGACCCGGTGATCAGGATTGGGGATTTGTGGATGTCAGGAC 120


3344R-2.IR_full       121 TGGCGCCCACATGTTCTACTGGCTGTACTACACCACCGCCAATGTCTCCAGTTACACGGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3344R-2.in silico     121 TGGCGCCCACATGTTCTACTGGCTGTACTACACCACCGCCAATGTCTCCAGTTACACGGA 180


3344R-2.IR_full       181 GCGTCCGCTGGCCATTTGGCTCCAAGGAGGTCCAGGTGCCTCCTCAACGGGATACGGAAA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3344R-2.in silico     181 GCGTCCGCTGGCCATTTGGCTCCAAGGAGGTCCAGGTGCCTCCTCAACGGGATACGGAAA 240


3344R-2.IR_full       241 CTTTGAGGAGTTGGGTCCCCTGAAGCTCGACGGNCAGCTACCGCGACTGGACTTGGGTGA 300
                          ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
3344R-2.in silico     241 CTTTGAGGAGTTGGGTCCCCTGAAGCTCGACGG-CAGCTACCGCGACTGGACTTGGGTGA 300


3344R-2.IR_full       301 AGGACATGAACGTGATGTTCATCGACAATCCCGTGGGCAGTGGTTTCAGCTACGTGGACG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3344R-2.in silico     301 AGGACATGAACGTGATGTTCATCGACAATCCCGTGGGCAGTGGTTTCAGCTACGTGGACG 360


3344R-2.IR_full       361 GATCTTCTTACTACACGACCAACAACAAGCAGATCGCCCTGGATCTCGTTGAGCTGATGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3344R-2.in silico     361 GATCTTCTTACTACACGACCAACAACAAGCAGATCGCCCTGGATCTCGTTGAGCTGATGA 420


3344R-2.IR_full       421 AGGGCTTCTACACAAACCACCCGGAATTCAAGACTGTGCCGCTGCACATCTTCTGCGAGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3344R-2.in silico     421 AGGGCTTCTACACAAACCACCCGGAATTCAAGACTGTGCCGCTGCACATCTTCTGCGAGA 480


3344R-2.IR_full       481 GTTATGGCGGAAAGATGGCCCC 502
                          ||||||||||||||||||||||
3344R-2.in silico     481 GTTATGGCGGAAAGATGGCCCC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_138207.2  CG3344-RA (CG3344), mRNA 
5.8   28  37  58  45  NM_167839.1  CG32483-RA (CG32483), mRNA 
0.2   NM_132997.2  CG8408-RA (CG8408), mRNA 
0   22  27  NM_135927.2  CG31821-RA (CG31821), mRNA 
0   11  NM_142579.2  CG4572-RB, transcript variant B (CG4572), mRNA 
0   11  NM_169879.1  CG4572-RC, transcript variant C (CG4572), mRNA 
0   11  NM_169878.1  CG4572-RA, transcript variant A (CG4572), mRNA 
0   NM_176360.1  CG32206-RC, transcript variant C (CG32206), mRNA 
0   NM_168794.2  CG32206-RB, transcript variant B (CG32206), mRNA 
0   15  NM_175960.3  CG33196-RB (dp), mRNA 
0   NM_057824.3  CG6601-RA (Rab6), mRNA 
0   NM_001032399.1  CG33955-RB (eys), mRNA 
0   NM_206081.1  CG18377-RD, transcript variant D (Cyp49a1), mRNA 
0   NM_136744.2  CG18377-RA, transcript variant A (Cyp49a1), mRNA 
0   NM_166685.1  CG3894-RB, transcript variant B (CG3894), mRNA 
0   NM_138119.5  CG3894-RA, transcript variant A (CG3894), mRNA 
0   NM_079959.2  CG4501-RA (bgm), mRNA 
0   NM_001043257.1  CG34157-RH, transcript variant H (Dys), mRNA 
0   NM_001043259.1  CG34157-RC, transcript variant C (Dys), mRNA 
0   NM_001043258.1  CG34157-RA, transcript variant A (Dys), mRNA 
0   NM_001043261.1  CG34157-RG, transcript variant G (Dys), mRNA 
0   NM_001043256.1  CG34157-RB, transcript variant B (Dys), mRNA 
0   NM_001043260.1  CG34157-RD, transcript variant D (Dys), mRNA 
0   NM_001043262.1  CG34157-RE, transcript variant E (Dys), mRNA 
0   NM_001043263.1  CG34157-RF, transcript variant F (Dys), mRNA 
0   NM_206236.1  CG15804-RB, transcript variant B (Dhc62B), mRNA 
0   NM_057737.2  CG15804-RA, transcript variant A (Dhc62B), mRNA 
0   NM_169610.1  CG6904-RA, transcript variant A (CG6904), mRNA 
0   NM_142165.2  CG6904-RB, transcript variant B (CG6904), mRNA 
0   NM_169611.1  CG6904-RC, transcript variant C (CG6904), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.