National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3335R-2 
 Symbol CG3335  Full Name CG3335 
 CG No CG3335  Old CG No CG3335 
 Synonyms Dm-RBD-1, Q9VT19, cg3335, CG3335 
 Accession No (Link to NCBI) NM_140080.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TCGGGAGAACGAAGAAGAGGATGATGAGGAACAGGAAGAATCTCGAGCTGCCAGAGATGA 60

                          |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| silico     61  CAGTGGAGTGGATGCAGATGCA-GGAGATGAGGATGGCTCAGGCGATGAGGCAGATGAGG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AAGAAGACACCGATAAACTGGCCGAAAAGCCCATCAGCGATCTTGAGTATATGAAATCCC 180

                          |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| silico     181 TGATGGCAACCACATCCGGCGAAGCTAC-TGCAAAGAAACCCAAAGCCAAGGCGGATAAA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TCAAATTTGGAGCTGTTCACCATTAAAATACACAATGTACCATACAACACCAAGCGCCAG 300

                          ||| ||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| silico     301 GAG-GTGCTAAAGTTTTTCAAGCCCCTGAAACCGTACTCCGTTCGGCTGCCCAGCAAAGT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TCACGGCTTCTGCTACGTGGGTTTTAAAACTGAGAAAGACATGGCCAAGGGAATGCTTAA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AAACAAGAGTTTCATCAAGGGCAAGCAAGTATTCTTCTCCGACTTTACAGAGAAGAACAA 480

3335R-2.IR_full       481 GGTGACCAAAGCGAGCAAGAGTG 503
                          ||||||||||||||||||||||| silico     481 GGTGACCAAAGCGAGCAAGAGTG 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140080.1  CG3335-RA (CG3335), mRNA 
0.2   NM_058131.3  CG6712-RA (CG6712), mRNA 
0   40  NM_136257.2  CG8677-RA (CG8677), mRNA 
0   NM_132061.1  CG5937-RA (CG5937), mRNA 
0   NM_170183.2  CG11120-RB, transcript variant B (CG11120), mRNA 
0   NM_143055.2  CG11120-RA, transcript variant A (CG11120), mRNA 
0   NM_137895.1  CG3800-RA (CG3800), mRNA 
0   NM_057824.3  CG6601-RA (Rab6), mRNA 
0   41  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   41  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   21  NM_206294.1  CG33275-RA, transcript variant A (CG33275), mRNA 
0   13  NM_001031918.1  CG1410-RA, transcript variant A (waw), mRNA 
0   13  NM_001031917.1  CG1414-RB, transcript variant B (bbx), mRNA 
0   13  NM_001031916.1  CG1414-RC, transcript variant C (bbx), mRNA 
0   NM_001032399.1  CG33955-RB (eys), mRNA 
0   NM_165566.1  CG18853-RA (CG18853), mRNA 
0   NM_164677.1  CG9131-RA, transcript variant A (slmo), mRNA 
0   NM_079966.2  CG9131-RB, transcript variant B (slmo), mRNA 
0   14  NM_132831.1  CG8184-RB (CG8184), mRNA 
0   NM_132549.2  CG15735-RA (CG15735), mRNA 
0   33  NM_132370.1  CG2989-RA (CG2989), mRNA 
0   NM_170042.1  CG31281-RA (CG31281), mRNA 
0   NM_058053.3  CG6939-RA, transcript variant A (Sbf), mRNA 
0   NM_169430.2  CG6939-RB, transcript variant B (Sbf), mRNA 
0   NM_140994.2  CG4268-RA, transcript variant A (Pitslre), mRNA 
0   NM_168869.1  CG4268-RC, transcript variant C (Pitslre), mRNA 
0   NM_057882.3  CG1609-RA (Gcn2), mRNA 
0   NM_135409.1  CG9468-RA (CG9468), mRNA 
0   NM_169594.2  CG3389-RA (Cad88C), mRNA 
0   NM_135513.3  CG5722-RA (NPC1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.