National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3335R-1 
 Symbol CG3335  Full Name CG3335 
 CG No CG3335  Old CG No CG3335 
 Synonyms Dm-RBD-1, Q9VT19, cg3335, CG3335 
 Accession No (Link to NCBI) NM_140080.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCGGGAGAACGAAGAAGAGGA 
 Primer Seq. 3'
aatctagaggtaccCACTCTTGCTCGCTTTGGTCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCGGNAGAAC GAAGAAgAGG ATGATGAGGA ACAGGAAGAA TCTCGAGCTG CCAGAGATGA 
0061 CAGTGGAGTG GATGCAGATG CANGGAGATG AGGATGGCTC AGGCGATGAG GCAGATGAGG 
0121 AAGAAGACAC CGATAAACTG GCCGAAAAGC CCATCAGCGA TCTTGAGTAT ATGAAATCCC 
0181 TGATGGCAAC CACATCCGGC GAAGCTACNT GCAAAGAAAC CCAAAGCCAA GGCGGATAAA 
0241 TCAAATTTGG AGCTGTTCAC CATTAAAATA CACAATGTAC CATACAACAC CAAGCGCCAG 
0301 GAGTGTGCTA AAGTTTTTCA AGCCCCTGAA ANCGTNCTCC GTTCGGCTGC CCAGCAAAGT 
0361 TCACGGCTTC TGCTACGTGG GTTTTAAAAC TGAGAAAGAC ATGGCCAAGG GAATGCTTAA 
0421 AAACAAGAGT TTCATCAAGG GCAAGCAAGT ATTCTTCTCC GACTTTACAG AGAAGAACAA 
0481 GGTGACCAAA GCGAGCAAGA GTG 
 in silico PCR Fragment
0001 TCGGGAGAAC GAAGAAGAGG ATGATGAGGA ACAGGAAGAA TCTCGAGCTG CCAGAGATGA 
0061 CAGTGGAGTG GATGCAGATG CA-GGAGATG AGGATGGCTC AGGCGATGAG GCAGATGAGG 
0121 AAGAAGACAC CGATAAACTG GCCGAAAAGC CCATCAGCGA TCTTGAGTAT ATGAAATCCC 
0181 TGATGGCAAC CACATCCGGC GAAGCTAC-T GCAAAGAAAC CCAAAGCCAA GGCGGATAAA 
0241 TCAAATTTGG AGCTGTTCAC CATTAAAATA CACAATGTAC CATACAACAC CAAGCGCCAG 
0301 GAG-GTGCTA AAGTTTTTCA AGCCCCTGAA ACCGTACTCC GTTCGGCTGC CCAGCAAAGT 
0361 TCACGGCTTC TGCTACGTGG GTTTTAAAAC TGAGAAAGAC ATGGCCAAGG GAATGCTTAA 
0421 AAACAAGAGT TTCATCAAGG GCAAGCAAGT ATTCTTCTCC GACTTTACAG AGAAGAACAA 
0481 GGTGACCAAA GCGAGCAAGA GTG 
 Assemble Data

3335R-1.IR_full       1   TCGGNAGAACGAAGAAGAGGATGATGAGGAACAGGAAGAATCTCGAGCTGCCAGAGATGA 60
                          |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
3335R-1.in silico     1   TCGGGAGAACGAAGAAGAGGATGATGAGGAACAGGAAGAATCTCGAGCTGCCAGAGATGA 60


3335R-1.IR_full       61  CAGTGGAGTGGATGCAGATGCANGGAGATGAGGATGGCTCAGGCGATGAGGCAGATGAGG 120
                          |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
3335R-1.in silico     61  CAGTGGAGTGGATGCAGATGCA-GGAGATGAGGATGGCTCAGGCGATGAGGCAGATGAGG 120


3335R-1.IR_full       121 AAGAAGACACCGATAAACTGGCCGAAAAGCCCATCAGCGATCTTGAGTATATGAAATCCC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3335R-1.in silico     121 AAGAAGACACCGATAAACTGGCCGAAAAGCCCATCAGCGATCTTGAGTATATGAAATCCC 180


3335R-1.IR_full       181 TGATGGCAACCACATCCGGCGAAGCTACNTGCAAAGAAACCCAAAGCCAAGGCGGATAAA 240
                          |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
3335R-1.in silico     181 TGATGGCAACCACATCCGGCGAAGCTAC-TGCAAAGAAACCCAAAGCCAAGGCGGATAAA 240


3335R-1.IR_full       241 TCAAATTTGGAGCTGTTCACCATTAAAATACACAATGTACCATACAACACCAAGCGCCAG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3335R-1.in silico     241 TCAAATTTGGAGCTGTTCACCATTAAAATACACAATGTACCATACAACACCAAGCGCCAG 300


3335R-1.IR_full       301 GAGTGTGCTAAAGTTTTTCAAGCCCCTGAAANCGTNCTCCGTTCGGCTGCCCAGCAAAGT 360
                          ||| ||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||
3335R-1.in silico     301 GAG-GTGCTAAAGTTTTTCAAGCCCCTGAAACCGTACTCCGTTCGGCTGCCCAGCAAAGT 360


3335R-1.IR_full       361 TCACGGCTTCTGCTACGTGGGTTTTAAAACTGAGAAAGACATGGCCAAGGGAATGCTTAA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3335R-1.in silico     361 TCACGGCTTCTGCTACGTGGGTTTTAAAACTGAGAAAGACATGGCCAAGGGAATGCTTAA 420


3335R-1.IR_full       421 AAACAAGAGTTTCATCAAGGGCAAGCAAGTATTCTTCTCCGACTTTACAGAGAAGAACAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3335R-1.in silico     421 AAACAAGAGTTTCATCAAGGGCAAGCAAGTATTCTTCTCCGACTTTACAGAGAAGAACAA 480


3335R-1.IR_full       481 GGTGACCAAAGCGAGCAAGAGTG 503
                          |||||||||||||||||||||||
3335R-1.in silico     481 GGTGACCAAAGCGAGCAAGAGTG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140080.1  CG3335-RA (CG3335), mRNA 
0.2   NM_058131.3  CG6712-RA (CG6712), mRNA 
0   40  NM_136257.2  CG8677-RA (CG8677), mRNA 
0   NM_132061.1  CG5937-RA (CG5937), mRNA 
0   NM_170183.2  CG11120-RB, transcript variant B (CG11120), mRNA 
0   NM_143055.2  CG11120-RA, transcript variant A (CG11120), mRNA 
0   NM_137895.1  CG3800-RA (CG3800), mRNA 
0   NM_057824.3  CG6601-RA (Rab6), mRNA 
0   41  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   41  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   21  NM_206294.1  CG33275-RA, transcript variant A (CG33275), mRNA 
0   13  NM_001031918.1  CG1410-RA, transcript variant A (waw), mRNA 
0   13  NM_001031917.1  CG1414-RB, transcript variant B (bbx), mRNA 
0   13  NM_001031916.1  CG1414-RC, transcript variant C (bbx), mRNA 
0   NM_001032399.1  CG33955-RB (eys), mRNA 
0   NM_165566.1  CG18853-RA (CG18853), mRNA 
0   NM_164677.1  CG9131-RA, transcript variant A (slmo), mRNA 
0   NM_079966.2  CG9131-RB, transcript variant B (slmo), mRNA 
0   14  NM_132831.1  CG8184-RB (CG8184), mRNA 
0   NM_132549.2  CG15735-RA (CG15735), mRNA 
0   33  NM_132370.1  CG2989-RA (CG2989), mRNA 
0   NM_170042.1  CG31281-RA (CG31281), mRNA 
0   NM_058053.3  CG6939-RA, transcript variant A (Sbf), mRNA 
0   NM_169430.2  CG6939-RB, transcript variant B (Sbf), mRNA 
0   NM_140994.2  CG4268-RA, transcript variant A (Pitslre), mRNA 
0   NM_168869.1  CG4268-RC, transcript variant C (Pitslre), mRNA 
0   NM_057882.3  CG1609-RA (Gcn2), mRNA 
0   NM_135409.1  CG9468-RA (CG9468), mRNA 
0   NM_169594.2  CG3389-RA (Cad88C), mRNA 
0   NM_135513.3  CG5722-RA (NPC1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.