National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3322R-3 
 Symbol LanB2  Full Name Laminin B2 
 CG No CG3322  Old CG No CG3322 
 Synonyms CT11145, LM-B2/gamma, gamma1, LAMB2A, DROLAMB2A, lamB2, anon-EST:fe2H3, Lam-B2, CG3322, LanB2 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGACTCCTGCTGATCGGAGTAT 
 Primer Seq. 3'
aatctagaggtaccCTCCGAGGTCCTCTTGTAAAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GACTCCTGCT GATCGGAGTA TTGTTCGCCA GCTGTTCCAC CGCCATCCTG GGTGCCCAGC 
0061 GTCCGCCCAT CAACTCCGCC GGAGGTCACG AACTGCGCGG AACCACCTTC ATGCCGGCCC 
0121 TGGAGTGCTA CGATCCATAC GGCAGGCCAC AGAAATGTCT GCCAGAATTT ATCAATGCTG 
0181 CCTATCAACT GCAAATTGAG TCAACTAATA CCTGTGGTGA GCAGAATGAC AACCACTTCT 
0241 GCATACAAAC CATGAACCAA AATCACAAAA ACTGCGAATT TTGCAAATAC AATGATCATA 
0301 ATCCATCCTT CTTGACGGAT TTGCATGATC CGCAAAGTCC AACGTGGTGG CAATCGGAGA 
0361 CCATGTTCGA GGGCATTCAG CACCCGAACT ATGTGAATCT GACTTTGCAC CTTGGAAAAT 
0421 CCTATGACAT CACCTACGTG CGCATTCTCT TCCGCTCACC AAGACCCGAA TCCTTTACGA 
0481 TTTACAAGAG GACCTCGGAG  
 in silico PCR Fragment
0001 gactcctgct gatcggagta ttgttcgcca gctgttccac cgccatcctg ggtgcccagc 
0061 gtccccccat caactccgcc ggaggtcacg aactgcgcgg aaccaccttc atgccggccc 
0121 tggagtgcta cgatccatac ggcaggccac agaaatgtct gccagaattt atcaatgctg 
0181 cctatcaact gcaaattgag tcaactaata cctgtggtga gcagaatgac aaccacttct 
0241 gcatacaaac catgaaccaa aatcacaaaa actgcgaatt ttgcaaatac aatgatcata 
0301 atccatcctt cttgacggat ttgcatgatc cgcaaagtcc aacgtggtgg caatcggaga 
0361 ccatgttcga gggcattcag cacccgaact atgtgaatct gactttgcac cttggaaaat 
0421 cctatgacat cacctacgtg cgcattctct tccgctcacc aagacccgaa tcctttacga 
0481 tttacaagag gacctcggag  
 Assemble Data

3322R-3.IR full       1   GACTCCTGCTGATCGGAGTATTGTTCGCCAGCTGTTCCACCGCCATCCTGGGTGCCCAGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3322R-3.in silico     1   GACTCCTGCTGATCGGAGTATTGTTCGCCAGCTGTTCCACCGCCATCCTGGGTGCCCAGC 60


3322R-3.IR full       61  GTCCGCCCATCAACTCCGCCGGAGGTCACGAACTGCGCGGAACCACCTTCATGCCGGCCC 120
                          |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
3322R-3.in silico     61  GTCCCCCCATCAACTCCGCCGGAGGTCACGAACTGCGCGGAACCACCTTCATGCCGGCCC 120


3322R-3.IR full       121 TGGAGTGCTACGATCCATACGGCAGGCCACAGAAATGTCTGCCAGAATTTATCAATGCTG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3322R-3.in silico     121 TGGAGTGCTACGATCCATACGGCAGGCCACAGAAATGTCTGCCAGAATTTATCAATGCTG 180


3322R-3.IR full       181 CCTATCAACTGCAAATTGAGTCAACTAATACCTGTGGTGAGCAGAATGACAACCACTTCT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3322R-3.in silico     181 CCTATCAACTGCAAATTGAGTCAACTAATACCTGTGGTGAGCAGAATGACAACCACTTCT 240


3322R-3.IR full       241 GCATACAAACCATGAACCAAAATCACAAAAACTGCGAATTTTGCAAATACAATGATCATA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3322R-3.in silico     241 GCATACAAACCATGAACCAAAATCACAAAAACTGCGAATTTTGCAAATACAATGATCATA 300


3322R-3.IR full       301 ATCCATCCTTCTTGACGGATTTGCATGATCCGCAAAGTCCAACGTGGTGGCAATCGGAGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3322R-3.in silico     301 ATCCATCCTTCTTGACGGATTTGCATGATCCGCAAAGTCCAACGTGGTGGCAATCGGAGA 360


3322R-3.IR full       361 CCATGTTCGAGGGCATTCAGCACCCGAACTATGTGAATCTGACTTTGCACCTTGGAAAAT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3322R-3.in silico     361 CCATGTTCGAGGGCATTCAGCACCCGAACTATGTGAATCTGACTTTGCACCTTGGAAAAT 420


3322R-3.IR full       421 CCTATGACATCACCTACGTGCGCATTCTCTTCCGCTCACCAAGACCCGAATCCTTTACGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3322R-3.in silico     421 CCTATGACATCACCTACGTGCGCATTCTCTTCCGCTCACCAAGACCCGAATCCTTTACGA 480


3322R-3.IR full       481 TTTACAAGAGGACCTCGGAG 500
                          ||||||||||||||||||||
3322R-3.in silico     481 TTTACAAGAGGACCTCGGAG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_079282.1  Laminin B2 CG3322-RA (LanB2), mRNA 
NM_136562.1  CG14744-RA (CG14744), mRNA 
NM_137536.2  CG15083-RA (CG15083), mRNA 
NM_135168.3  Gef26 CG9491-RA (Gef26), mRNA 
NM_079913.2  sunday driver CG8110-RA, transcript variant A (syd), mRNA 
NM_168245.2  sunday driver CG8110-RB, transcript variant B (syd), mRNA 
NM_142495.1  CG14299-RA, transcript variant A (CG14299), mRNA 
NM_135797.2  CG6523-RA (CG6523), mRNA 
NM_167902.1  CG7955-RA, transcript variant A (CG7955), mRNA 
NM_078670.2  Dynein heavy chain at 16F CG7092-RA (Dhc16F), mRNA 
NM_139377.2  CG7955-RC, transcript variant C (CG7955), mRNA 
NM_136764.2  CG12340-RA (CG12340), mRNA 
NM_167903.1  CG7955-RB, transcript variant B (CG7955), mRNA 
NM_169335.2  Synapsin CG3985-RC, transcript variant C (Syn), mRNA 
NM_169332.2  Synapsin CG3985-RA, transcript variant A (Syn), mRNA 
NM_176451.2  Synapsin CG3985-RF, transcript variant F (Syn), mRNA 
NM_140376.1  CG11281-RA (CG11281), mRNA 
NM_169334.2  Synapsin CG3985-RD, transcript variant D (Syn), mRNA 
NM_169333.2  Synapsin CG3985-RE, transcript variant E (Syn), mRNA 
NM_169441.1  Heat-shock-protein-70Aa CG31366-RA (Hsp70Aa), mRNA 
NM_080188.2  Heat-shock-protein-70Bb CG31359-RA (Hsp70Bb), mRNA 
NM_141952.1  Heat-shock-protein-70Bc CG6489-RA (Hsp70Bc), mRNA 
NM_080059.2  Heat-shock-protein-70Ab CG18743-RA (Hsp70Ab), mRNA 
NM_169469.1  Heat-shock-protein-70Ba CG31449-RA (Hsp70Ba), mRNA 
NM_176486.1  Hsp70Bbb CG5834-RA (Hsp70Bbb), mRNA 
NM_169250.1  CG11980-RB, transcript variant B (CG11980), mRNA 
NM_141600.1  CG11980-RC, transcript variant C (CG11980), mRNA 
NM_142364.1  CG17283-RA (CG17283), mRNA 
NM_169251.1  CG11980-RA, transcript variant A (CG11980), mRNA 
NM_170053.2  cap-n-collar CG17894-RC, transcript variant C (cnc), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.