National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3322R-2 
 Symbol LanB2  Full Name Laminin B2 
 CG No CG3322  Old CG No CG3322 
 Synonyms CT11145, LM-B2/gamma, gamma1, LAMB2A, DROLAMB2A, lamB2, anon-EST:fe2H3, Lam-B2, CG3322, LanB2 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGACTCCTGCTGATCGGAGTAT 
 Primer Seq. 3'
aatctagaggtaccCTCCGAGGTCCTCTTGTAAAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

3322R-2.IR full       1   GACTCCTGCTGATCGGAGTATTGTTCGCCAGCTGTTCCACCGCCATCCTGGGTGCCCAGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3322R-2.in silico     1   GACTCCTGCTGATCGGAGTATTGTTCGCCAGCTGTTCCACCGCCATCCTGGGTGCCCAGC 60


3322R-2.IR full       61  GTCCGCCCATCAACTCCGCCGGAGGTCACGAACTGCGCGGAACCACCTTCATGCCGGCCC 120
                          |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
3322R-2.in silico     61  GTCCCCCCATCAACTCCGCCGGAGGTCACGAACTGCGCGGAACCACCTTCATGCCGGCCC 120


3322R-2.IR full       121 TGGAGTGCTACGATCCATACGGCAGGCCACAGAAATGTCTGCCAGAATTTATCAATGCTG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3322R-2.in silico     121 TGGAGTGCTACGATCCATACGGCAGGCCACAGAAATGTCTGCCAGAATTTATCAATGCTG 180


3322R-2.IR full       181 CCTATCAACTGCAAATTGAGTCAACTAATACCTGTGGTGAGCAGAATGACAACCACTTCT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3322R-2.in silico     181 CCTATCAACTGCAAATTGAGTCAACTAATACCTGTGGTGAGCAGAATGACAACCACTTCT 240


3322R-2.IR full       241 GCATACAAACCATGAACCAAAATCACAAAAACTGCGAATTTTGCAAATACAATGATCATA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3322R-2.in silico     241 GCATACAAACCATGAACCAAAATCACAAAAACTGCGAATTTTGCAAATACAATGATCATA 300


3322R-2.IR full       301 ATCCATCCTTCTTGACGGATTTGCATGATCCGCAAAGTCCAACGTGGTGGCAATCGGAGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3322R-2.in silico     301 ATCCATCCTTCTTGACGGATTTGCATGATCCGCAAAGTCCAACGTGGTGGCAATCGGAGA 360


3322R-2.IR full       361 CCATGTTCGAGGGCATTCAGCACCCGAACTATGTGAATCTGACTTTGCACCTTGGAAAAT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3322R-2.in silico     361 CCATGTTCGAGGGCATTCAGCACCCGAACTATGTGAATCTGACTTTGCACCTTGGAAAAT 420


3322R-2.IR full       421 CCTATGACATCACCTACGTGCGCATTCTCTTCCGCTCACCAAGACCCGAATCCTTTACGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3322R-2.in silico     421 CCTATGACATCACCTACGTGCGCATTCTCTTCCGCTCACCAAGACCCGAATCCTTTACGA 480


3322R-2.IR full       481 TTTACAAGAGGACCTCGGAG 500
                          ||||||||||||||||||||
3322R-2.in silico     481 TTTACAAGAGGACCTCGGAG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_079282.1  Laminin B2 CG3322-RA (LanB2), mRNA 
NM_136562.1  CG14744-RA (CG14744), mRNA 
NM_137536.2  CG15083-RA (CG15083), mRNA 
NM_135168.3  Gef26 CG9491-RA (Gef26), mRNA 
NM_079913.2  sunday driver CG8110-RA, transcript variant A (syd), mRNA 
NM_168245.2  sunday driver CG8110-RB, transcript variant B (syd), mRNA 
NM_142495.1  CG14299-RA, transcript variant A (CG14299), mRNA 
NM_135797.2  CG6523-RA (CG6523), mRNA 
NM_167902.1  CG7955-RA, transcript variant A (CG7955), mRNA 
NM_078670.2  Dynein heavy chain at 16F CG7092-RA (Dhc16F), mRNA 
NM_139377.2  CG7955-RC, transcript variant C (CG7955), mRNA 
NM_136764.2  CG12340-RA (CG12340), mRNA 
NM_167903.1  CG7955-RB, transcript variant B (CG7955), mRNA 
NM_169335.2  Synapsin CG3985-RC, transcript variant C (Syn), mRNA 
NM_169332.2  Synapsin CG3985-RA, transcript variant A (Syn), mRNA 
NM_176451.2  Synapsin CG3985-RF, transcript variant F (Syn), mRNA 
NM_140376.1  CG11281-RA (CG11281), mRNA 
NM_169334.2  Synapsin CG3985-RD, transcript variant D (Syn), mRNA 
NM_169333.2  Synapsin CG3985-RE, transcript variant E (Syn), mRNA 
NM_169441.1  Heat-shock-protein-70Aa CG31366-RA (Hsp70Aa), mRNA 
NM_080188.2  Heat-shock-protein-70Bb CG31359-RA (Hsp70Bb), mRNA 
NM_141952.1  Heat-shock-protein-70Bc CG6489-RA (Hsp70Bc), mRNA 
NM_080059.2  Heat-shock-protein-70Ab CG18743-RA (Hsp70Ab), mRNA 
NM_169469.1  Heat-shock-protein-70Ba CG31449-RA (Hsp70Ba), mRNA 
NM_176486.1  Hsp70Bbb CG5834-RA (Hsp70Bbb), mRNA 
NM_169250.1  CG11980-RB, transcript variant B (CG11980), mRNA 
NM_141600.1  CG11980-RC, transcript variant C (CG11980), mRNA 
NM_142364.1  CG17283-RA (CG17283), mRNA 
NM_169251.1  CG11980-RA, transcript variant A (CG11980), mRNA 
NM_170053.2  cap-n-collar CG17894-RC, transcript variant C (cnc), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
++ 
VM
VB
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.