National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3318R-3 
 Symbol Dat  Full Name Dopamine N acetyltransferase 
 CG No CG3318  Old CG No CG3318 
 Synonyms aaNAT, Dat1, AA-NAT1, aaNat, NAT1, aaNAT1, CG3318, Aanat1, Dat 
 Accession No (Link to NCBI) NM_206212.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGAAGTGCAGAAGCTGCCG 
 Primer Seq. 3'
aatctagaggtaccTCGAAGATGTTGAACTGCTCC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGGAAGTGC AGAAGCTGCC GGACCAGTCG CTGATATCCA GCATGATGTT GGACTCCCGA 
0061 TGTGGGCTGA ACGACTTGTA TCCGATCGCC CGGCTGACAC AGAAAATGGA GGACGCATTG 
0121 ACCGTCTCTG GGAAGCCAGC CGCATGCCCC GTCGACCAGG ATTGCCCCTA CACCATCGAA 
0181 CTGATCCAGC CGGAGGATGG GGAGGCGGTG ATAGCCATGC TCAAGACCTT TTTCTTCAAG 
0241 GATGAACCGC TGAACACCTT CCTCGACCTT GGCGAGTGCA AGGAGCTGGA GAAGTACTCC 
0301 CTGAAACCGC TACCCGACAA CTGCTCCTAC AAGGCGGTCA ACAAGAAGGG CGAGATTATC 
0361 GGTGTGTTCC TAAATGGACT TATGAGGCGT CCGTCCCCCG ATGATGTGCC CGAAAAGGCG 
0421 GCCGACTCCT GTGAACATCC CAAATTCAAG AAGATCCTCT CGCTGATGGA CCACGTGGAG 
0481 GAGCAGTTCA ACATCTTCGA  
 in silico PCR Fragment
0001 ATGGAAGTGC AGAAGCTGCC GGACCAGTCG CTGATATCCA GCATGATGTT GGACTCCCGA 
0061 TGTGGGCTGA ACGACTTGTA TCCGATCGCC CGGCTGACAC AGAAAATGGA GGACGCATTG 
0121 ACCGTCTCTG GGAAGCCAGC CGCATGCCCC GTCGACCAGG ACTGCCCCTA CACCATCGAA 
0181 CTGATCCAGC CGGAGGATGG GGAGGCGGTG ATAGCCATGC TCAAGACCTT TTTCTTCAAG 
0241 GATGAACCGC TGAACACCTT CCTCGACCTT GGCGAGTGCA AGGAGCTGGA GAAGTACTCC 
0301 CTGAAACCGC TACCCGACAA CTGCTCCTAC AAGGCGGTCA ACAAGAAGGG CGAGATTATC 
0361 GGTGTGTTCC TAAATGGACT TATGAGGCGT CCGTCCCCCG ATGATGTGCC CGAAAAGGCG 
0421 GCCGACTCCT GTGAACATCC CAAATTCAAG AAGATCCTCT CGCTGATGGA CCACGTGGAG 
0481 GAGCAGTTCA ACATCTTCGA  
 Assemble Data

3318R-3.IR_full       1   ATGGAAGTGCAGAAGCTGCCGGACCAGTCGCTGATATCCAGCATGATGTTGGACTCCCGA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3318R-3.in silico     1   ATGGAAGTGCAGAAGCTGCCGGACCAGTCGCTGATATCCAGCATGATGTTGGACTCCCGA 60


3318R-3.IR_full       61  TGTGGGCTGAACGACTTGTATCCGATCGCCCGGCTGACACAGAAAATGGAGGACGCATTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3318R-3.in silico     61  TGTGGGCTGAACGACTTGTATCCGATCGCCCGGCTGACACAGAAAATGGAGGACGCATTG 120


3318R-3.IR_full       121 ACCGTCTCTGGGAAGCCAGCCGCATGCCCCGTCGACCAGGATTGCCCCTACACCATCGAA 180
                          ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
3318R-3.in silico     121 ACCGTCTCTGGGAAGCCAGCCGCATGCCCCGTCGACCAGGACTGCCCCTACACCATCGAA 180


3318R-3.IR_full       181 CTGATCCAGCCGGAGGATGGGGAGGCGGTGATAGCCATGCTCAAGACCTTTTTCTTCAAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3318R-3.in silico     181 CTGATCCAGCCGGAGGATGGGGAGGCGGTGATAGCCATGCTCAAGACCTTTTTCTTCAAG 240


3318R-3.IR_full       241 GATGAACCGCTGAACACCTTCCTCGACCTTGGCGAGTGCAAGGAGCTGGAGAAGTACTCC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3318R-3.in silico     241 GATGAACCGCTGAACACCTTCCTCGACCTTGGCGAGTGCAAGGAGCTGGAGAAGTACTCC 300


3318R-3.IR_full       301 CTGAAACCGCTACCCGACAACTGCTCCTACAAGGCGGTCAACAAGAAGGGCGAGATTATC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3318R-3.in silico     301 CTGAAACCGCTACCCGACAACTGCTCCTACAAGGCGGTCAACAAGAAGGGCGAGATTATC 360


3318R-3.IR_full       361 GGTGTGTTCCTAAATGGACTTATGAGGCGTCCGTCCCCCGATGATGTGCCCGAAAAGGCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3318R-3.in silico     361 GGTGTGTTCCTAAATGGACTTATGAGGCGTCCGTCCCCCGATGATGTGCCCGAAAAGGCG 420


3318R-3.IR_full       421 GCCGACTCCTGTGAACATCCCAAATTCAAGAAGATCCTCTCGCTGATGGACCACGTGGAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3318R-3.in silico     421 GCCGACTCCTGTGAACATCCCAAATTCAAGAAGATCCTCTCGCTGATGGACCACGTGGAG 480


3318R-3.IR_full       481 GAGCAGTTCAACATCTTCGA 500
                          ||||||||||||||||||||
3318R-3.in silico     481 GAGCAGTTCAACATCTTCGA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_206212.1  CG3318-RB, transcript variant B (Dat), mRNA 
86.3   416  NM_079115.2  CG3318-RA, transcript variant A (Dat), mRNA 
0.2   NM_079029.3  CG8295-RA, transcript variant A (Mlf), mRNA 
0.2   NM_166123.3  CG8295-RB, transcript variant B (Mlf), mRNA 
0.2   NM_166122.2  CG8295-RC, transcript variant C (Mlf), mRNA 
0.2   NM_206125.1  CG8295-RD, transcript variant D (Mlf), mRNA 
0   NM_141895.2  CG14740-RA (CG14740), mRNA 
0   NM_137809.1  CG3292-RA (CG3292), mRNA 
0   NM_137892.2  CG3700-RA (CG3700), mRNA 
0   NM_140396.1  CG10738-RB, transcript variant B (CG10738), mRNA 
0   NM_136028.2  CG7180-RA (CG7180), mRNA 
0   NM_001043114.1  CG33484-RD, transcript variant D (zormin), mRNA 
0   NM_001043112.1  CG33484-RB, transcript variant B (zormin), mRNA 
0   NM_206240.1  CG33484-RA, transcript variant A (zormin), mRNA 
0   NM_001043113.1  CG33484-RC, transcript variant C (zormin), mRNA 
0   NM_001015311.1  CG40374-PA.3 (CG40374), mRNA 
0   NM_136059.2  CG10369-RA (Irk3), mRNA 
0   10  NM_141238.1  CG17387-RA (CG17387), mRNA 
0   NM_080248.1  CG6725-RA (Sulf1), mRNA 
0   NM_142581.1  CG4562-RA (CG4562), mRNA 
0   NM_079270.1  CG4190-RA (Hsp67Bc), mRNA 
0   NM_001038840.1  CG34007-RA (CG34007), mRNA 
0   NM_143325.2  CG12876-RA (CG12876), mRNA 
0   NM_137051.1  CG13337-RA (CG13337), mRNA 
0   NM_166087.1  CG8153-RC, transcript variant C (mus210), mRNA 
0   NM_057513.3  CG8153-RA, transcript variant A (mus210), mRNA 
0   NM_057514.3  CG8153-RB, transcript variant B (mus210), mRNA 
0   NM_143511.2  CG7946-RA (CG7946), mRNA 
0   23  NM_135002.1  CG15635-RA (CG15635), mRNA 
0   NM_140828.2  CG3797-RA (CG3797), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.