National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3299R-1 
 Symbol Vinc  Full Name Vinculin 
 CG No CG3299  Old CG No CG3299 
 Synonyms vinc, EG:103B4.1, CT11081, CG3299, Dmvincp, Vin2EF, Vin, Vinc 
 Accession No (Link to NCBI) NM_057472.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACCTCCTCGCTGCTGCTTTGC 
 Primer Seq. 3'
aatctagaggtaccGATAGCCACTCGTTGGCCTGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACCTCCTCGC TGCTGCTTTG cTTCGACGAG AGTGAGGTGC GGAAGATCAT CCAGGAGTGC 
0061 AAGAGGGTAC TGGACTACTT GGCCGTGGCG GAGGTGATAA ACACCATGGA ACAGCTGGTG 
0121 CAGTTCCTCA AGGACCTCTC GCCCTGTCTG AGCAAGGTGC ACCGGGAGGT GGGCGCCCGC 
0181 GAGAAGGAGC TGACCCACCA GGTGCACAGC GAGATATTGG TGCGATGCTT GGAGCAAGTG 
0241 AAGACCCTGG CCCCAATCCT CATCTGCAGT ATGAAGGTCT ACATCCACAT TGTGGAGCAG 
0301 CAGGGCCGCG GCAGCTGAGG AAGCGGCTGA GAACAGGAAC TACCTGGCCG CCAGGATGAG 
0361 CGACGAGCTG CAGGAGATCA TCCGCGTGCT GCAGCTGACT ACCCTACGAT GAGGACACCA 
0421 GCGAGCTGGA CAACCTCACT GTGCTGAAGA AGCTCTCCAA TGCCATTTCC AACAAAATGG 
0481 AGCAGGCCAA CGAGTGGCTA TC 
 in silico PCR Fragment
0001 ACCTCCTCGC TGCTGCTTTG CTTCGACGAG AGTGAGGTGC GGAAGATCAT CCAGGAGTGC 
0061 AAGAGGGTAC TGGACTACTT AGCCGTGGCG GAGGTGATAA ACACCATGGA ACAGCTGGTG 
0121 CAGTTCCTCA AGGACCTCTC GCCCTGTCTG AGCAAGGTGC ACCGGGAGGT GGGCGCCCGC 
0181 GAGAAGGAGC TGACCCACCA GGTGCACAGC GAGATATTGG TGCGATGCTT GGAGCAAGTG 
0241 AAGACCCTGG CCCCAATCCT CATCTGCAGT ATGAAGGTCT ACATCCACAT TGTGGAGCAG 
0301 CAGGGCCGCG G-AGCTGAGG AAGCGGCTGA GAACAGGAAC TACCTGGCCG CCAGGATGAG 
0361 CGACGAGCTG CAGGAGATCA TCCGCGTGCT GCAGCTGACT A-CCTACGAT GAGGACACCA 
0421 GCGAGCTGGA CAACCTCACT GTGCTGAAAA AGCTCTCCAA TGCCATTTCC AACAAAATGG 
0481 AGCAGGCCAA CGAGTGGCTA TC 
 Assemble Data

3299R-1.IR_full       1   ACCTCCTCGCTGCTGCTTTGCTTCGACGAGAGTGAGGTGCGGAAGATCATCCAGGAGTGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3299R-1.in silico     1   ACCTCCTCGCTGCTGCTTTGCTTCGACGAGAGTGAGGTGCGGAAGATCATCCAGGAGTGC 60


3299R-1.IR_full       61  AAGAGGGTACTGGACTACTTGGCCGTGGCGGAGGTGATAAACACCATGGAACAGCTGGTG 120
                          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
3299R-1.in silico     61  AAGAGGGTACTGGACTACTTAGCCGTGGCGGAGGTGATAAACACCATGGAACAGCTGGTG 120


3299R-1.IR_full       121 CAGTTCCTCAAGGACCTCTCGCCCTGTCTGAGCAAGGTGCACCGGGAGGTGGGCGCCCGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3299R-1.in silico     121 CAGTTCCTCAAGGACCTCTCGCCCTGTCTGAGCAAGGTGCACCGGGAGGTGGGCGCCCGC 180


3299R-1.IR_full       181 GAGAAGGAGCTGACCCACCAGGTGCACAGCGAGATATTGGTGCGATGCTTGGAGCAAGTG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3299R-1.in silico     181 GAGAAGGAGCTGACCCACCAGGTGCACAGCGAGATATTGGTGCGATGCTTGGAGCAAGTG 240


3299R-1.IR_full       241 AAGACCCTGGCCCCAATCCTCATCTGCAGTATGAAGGTCTACATCCACATTGTGGAGCAG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3299R-1.in silico     241 AAGACCCTGGCCCCAATCCTCATCTGCAGTATGAAGGTCTACATCCACATTGTGGAGCAG 300


3299R-1.IR_full       301 CAGGGCCGCGGCAGCTGAGGAAGCGGCTGAGAACAGGAACTACCTGGCCGCCAGGATGAG 360
                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
3299R-1.in silico     301 CAGGGCCGCGG-AGCTGAGGAAGCGGCTGAGAACAGGAACTACCTGGCCGCCAGGATGAG 360


3299R-1.IR_full       361 CGACGAGCTGCAGGAGATCATCCGCGTGCTGCAGCTGACTACCCTACGATGAGGACACCA 420
                          ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
3299R-1.in silico     361 CGACGAGCTGCAGGAGATCATCCGCGTGCTGCAGCTGACTA-CCTACGATGAGGACACCA 420


3299R-1.IR_full       421 GCGAGCTGGACAACCTCACTGTGCTGAAGAAGCTCTCCAATGCCATTTCCAACAAAATGG 480
                          |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
3299R-1.in silico     421 GCGAGCTGGACAACCTCACTGTGCTGAAAAAGCTCTCCAATGCCATTTCCAACAAAATGG 480


3299R-1.IR_full       481 AGCAGGCCAACGAGTGGCTATC 502
                          ||||||||||||||||||||||
3299R-1.in silico     481 AGCAGGCCAACGAGTGGCTATC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057472.2  CG3299-RA (Vinc), mRNA 
0   NM_057473.3  CG8987-RA (tam), mRNA 
0   NM_205892.1  CG3539-RC, transcript variant C (Slh), mRNA 
0   NM_205891.1  CG3539-RD, transcript variant D (Slh), mRNA 
0   NM_167666.1  CG14217-RE, transcript variant E (Tao-1), mRNA 
0   NM_167665.1  CG14217-RD, transcript variant D (Tao-1), mRNA 
0   NM_141700.1  CG16904-RA (CG16904), mRNA 
0   NM_001038815.1  CG17988-RB (Ance-3), mRNA 
0   NM_164532.1  CG9664-RA, transcript variant A (CG9664), mRNA 
0   NM_164533.1  CG9664-RB, transcript variant B (CG9664), mRNA 
0   NM_134915.2  CG9664-RC, transcript variant C (CG9664), mRNA 
0   NM_078509.2  CG3929-RA (dx), mRNA 
0   NM_176586.2  CG7933-RA, transcript variant A (janA), mRNA 
0   NM_176585.1  CG7933-RB, transcript variant B (janA), mRNA 
0   NM_206588.1  CG7933-RC, transcript variant C (janA), mRNA 
0   NM_132116.1  CG14441-RA (CG14441), mRNA 
0   NM_139811.1  CG10063-RA (CG10063), mRNA 
0   12  NM_169061.1  CG10063-RA (CG10063), mRNA,4,5,-tris-phosphate receptor CG1063-RA, transcript variant A (Itp-r83A), mRNA 
0   10  NM_169060.1  CG10063-RA (CG10063), mRNA,4,5,-tris-phosphate receptor CG1063-RA, transcript variant A (Itp-r83A), mRNA,4,5,-tris-phosphate receptor CG1063-RB, transcript variant B (Itp-r83A), mRNA 
0   NM_141795.2  CG6693-RA (CG6693), mRNA 
0   NM_137832.1  CG4554-RA (CG4554), mRNA 
0   NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0   NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0   NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0   NM_170468.1  CG31029-RA (CG31029), mRNA 
0   NM_137399.2  CG6459-RA (CG6459), mRNA 
0   NM_057951.2  CG9210-RA, transcript variant A (Ac13E), mRNA 
0   NM_001014745.1  CG9210-RB, transcript variant B (Ac13E), mRNA 
0   NM_130663.2  CG2675-RA (Csat), mRNA 
0   NM_057783.2  CG3954-RB, transcript variant B (csw), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.