National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3274R-2 
 Symbol Bap170  Full Name Brahma associated protein 170kD 
 CG No CG3274  Old CG No CG3274 
 Synonyms BAP170, CG3274, BcDNA:GH12174, Bap170 
 Accession No (Link to NCBI) NM_136372.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
[Please submit your publication]
He X, Yu J, Wang M, Cheng Y, Han Y, Yang S, Shi G, Sun L, Fang Y, Gong ST, Wang Z, Fu YX, Pan L, Tang H.
Bap180/Baf180 is required to maintain homeostasis of intestinal innate immune response in Drosophila and mice.
Nat Microbiol (2017) 2 17056 [ PubMed ID = 28418397 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGAGCGCCACCACCATCGACAACGTACGGGTGCTGCTTCAGTCGCTGCCTGCTGCCGCC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GTAAACAGCGCCACTCAGCCGGGCGATCTACAGACGCCGGGCAAGATTGCGGCCCCAGCG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ACTCCCCTTCGCGCCAAGAATCCCGCCCAATTACAGATCATGCCGGAGAAGGTCGAGGAG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ATGCCGCCGTCACCTCCGGAGGAGTTCTGGAGGGACCTGCAGCAGTTTCACGAACGACGC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GGCACTCCATTGACACAGCCCGCCAGGATCAGCGGTAAGCATGTCGACCTGTACAAGCTG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TACAACGAGGTAACCGAACGAGGCGGCTTTAATAAGGTGACCATGCGGGACGAGTGGGAC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GAGGTGTACAGCGCCATGGAGACATTGCGGGAGCGCTGCGTTAACGGAACGGCTAGTATC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AAGCACATCTACAGACGCTACCTGGACAAGTACGAACGGTTGAACTTCTTTGGCGAGGAT 480

3274R-2.IR_full       481 CCAGACAAGATGGAGGCTCTG 501
                          ||||||||||||||||||||| silico     481 CCAGACAAGATGGAGGCTCTG 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   483  NM_136372.2  CG3274-RA (Bap170), mRNA 
0   NM_080511.2  CG6440-RA (Dms), mRNA 
0   18  NM_141666.2  CG9492-RA (CG9492), mRNA 
0   NM_136409.1  CG17002-RB (CG17002), mRNA 
0   NM_079059.2  CG5519-RA (Gbp), mRNA 
0   13  NM_168103.1  CG7507-RB, transcript variant B (Dhc64C), mRNA 
0   12  NM_079205.3  CG7507-RA, transcript variant A (Dhc64C), mRNA 
0   NM_137076.1  CG6701-RA (CG6701), mRNA 
0   NM_001043013.1  CG17800-PBD (Dscam), mRNA 
0   NM_001014599.1  CG9390-RC, transcript variant C (AcCoAS), mRNA 
0   NM_168894.1  CG9390-RA, transcript variant A (AcCoAS), mRNA 
0   NM_079472.2  CG9390-RB, transcript variant B (AcCoAS), mRNA 
0   NM_168802.1  CG32210-RA (CG32210), mRNA 
0   NM_132193.1  CG1514-RA (CG1514), mRNA 
0   NM_141220.1  CG9783-RA (CG9783), mRNA 
0   NM_137339.2  CG9646-RA (CG9646), mRNA 
0   NM_132794.2  CG18210-RA (CG18210), mRNA 
0   NM_206153.1  CG33130-RC, transcript variant C (l(2)k07433), mRNA 
0   NM_176218.1  CG33130-RA, transcript variant A (l(2)k07433), mRNA 
0   NM_206154.1  CG33130-RB, transcript variant B (l(2)k07433), mRNA 
0   NM_138036.2  CG3209-RA, transcript variant A (CG3209), mRNA 
0   NM_166658.1  CG3209-RB, transcript variant B (CG3209), mRNA 
0   11  NM_140329.2  CG4107-RA (Pcaf), mRNA 
0   NM_141444.1  CG10061-RA (l(3)s2214), mRNA 
0   NM_133101.2  CG7101-RA (CG7101), mRNA 
0   NM_079315.2  CG10436-RA (Pbprp1), mRNA 
0   NM_131971.2  CG4068-RA, transcript variant A (CG4068), mRNA 
0   NM_206627.1  CG4068-RB, transcript variant B (CG4068), mRNA 
0   NM_169145.1  CG15186-RB, transcript variant B (CG15186), mRNA 
0   NM_206436.1  CG15186-RC, transcript variant C (CG15186), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.