National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3274R-1 
 Symbol Bap170  Full Name Brahma associated protein 170kD 
 CG No CG3274  Old CG No CG3274 
 Synonyms BAP170, CG3274, BcDNA:GH12174, Bap170 
 Accession No (Link to NCBI) NM_136372.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
He X, Yu J, Wang M, Cheng Y, Han Y, Yang S, Shi G, Sun L, Fang Y, Gong ST, Wang Z, Fu YX, Pan L, Tang H.
Bap180/Baf180 is required to maintain homeostasis of intestinal innate immune response in Drosophila and mice.
Nat Microbiol (2017) 2 17056 [ PubMed ID = 28418397 ] [ RRC reference ]

Bauke AC, Sasse S, Matzat T, Klämbt C.
A transcriptional network controlling glial development in the Drosophila visual system.
Development (2015) 142(12) 2184-93 [ PubMed ID = 26015542 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGAGCGCCACCACCATCGAC 
 Primer Seq. 3'
aatctagaggtaccCAGAGCCTCCATCTTGTCTGG 
 Predicted Fragment Size
501 
 IR fragment full Seq
0001 ATGAGCGCCA CCACCATCGA CAACGTACGG GTGCTGCTTC AGTCGCTGCC TGCTGCCGCC 
0061 GTAAACAGCG CCACTCAGCC GGGCGATCTA CAGACGCCGG GCAAGATTGC GGCCCCAGCG 
0121 ACTCCCCTTC GCGCCAAGAA TCCCGCCCAA TTACAGATCA TGCCGGAGAA GGTCGAGGAG 
0181 ATGCCGCCGT CACCTCCGGA GGAGTTCTGG AGGGACCTGC AGCAGTTTCA CGAACGACGC 
0241 GGCACTCCAT TGACACAGCC CGCCAGGATC AGCGGTAAGC ATGTCGACCT GTACAAGCTG 
0301 TACAACGAGG TAACCGAACG AGGCGGCTTT AATAAGGTGA CCATGCGGGA CGAGTGGGAC 
0361 GAGGTGTACA GCGCCATGGA GACATTGCGG GAGCgCTGCG TTAACGGAAC GGCTAGTATC 
0421 AAGCACATCT ACAGACGCTA CCTGGACAAG TACGAACGGT TGAACTTCTT TGGCGAGGAT 
0481 CCAGACAAGA TGGAGGCTCT G 
 in silico PCR Fragment
0001 ATGAGCGCCA CCACCATCGA CAACGTACGG GTGCTGCTTC AGTCGCTGCC TGCTGCCGCC 
0061 GTAAACAGCG CCACTCAGCC GGGCGATCTA CAGACGCCGG GCAAGATTGC GGCCCCAGCG 
0121 ACTCCCCTTC GCGCCAAGAA TCCCGCCCAA TTACAGATCA TGCCGGAGAA GGTCGAGGAG 
0181 ATGCCGCCGT CACCTCCGGA GGAGTTCTGG AGGGACCTGC AGCAGTTTCA CGAACGACGC 
0241 GGCACTCCAT TGACACAGCC CGCCAGGATC AGCGGTAAGC ATGTCGACCT GTACAAGCTG 
0301 TACAACGAGG TAACCGAACG AGGCGGCTTT AATAAGGTGA CCATGCGGGA CGAGTGGGAC 
0361 GAGGTGTACA GCGCCATGGA GACATTGCGG GAGCGCTGCG TTAACGGAAC GGCTAGTATC 
0421 AAGCACATCT ACAGACGCTA CCTGGACAAG TACGAACGGT TGAACTTCTT TGGCGAGGAT 
0481 CCAGACAAGA TGGAGGCTCT G 
 Assemble Data

3274R-1.IR_full       1   ATGAGCGCCACCACCATCGACAACGTACGGGTGCTGCTTCAGTCGCTGCCTGCTGCCGCC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3274R-1.in silico     1   ATGAGCGCCACCACCATCGACAACGTACGGGTGCTGCTTCAGTCGCTGCCTGCTGCCGCC 60


3274R-1.IR_full       61  GTAAACAGCGCCACTCAGCCGGGCGATCTACAGACGCCGGGCAAGATTGCGGCCCCAGCG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3274R-1.in silico     61  GTAAACAGCGCCACTCAGCCGGGCGATCTACAGACGCCGGGCAAGATTGCGGCCCCAGCG 120


3274R-1.IR_full       121 ACTCCCCTTCGCGCCAAGAATCCCGCCCAATTACAGATCATGCCGGAGAAGGTCGAGGAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3274R-1.in silico     121 ACTCCCCTTCGCGCCAAGAATCCCGCCCAATTACAGATCATGCCGGAGAAGGTCGAGGAG 180


3274R-1.IR_full       181 ATGCCGCCGTCACCTCCGGAGGAGTTCTGGAGGGACCTGCAGCAGTTTCACGAACGACGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3274R-1.in silico     181 ATGCCGCCGTCACCTCCGGAGGAGTTCTGGAGGGACCTGCAGCAGTTTCACGAACGACGC 240


3274R-1.IR_full       241 GGCACTCCATTGACACAGCCCGCCAGGATCAGCGGTAAGCATGTCGACCTGTACAAGCTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3274R-1.in silico     241 GGCACTCCATTGACACAGCCCGCCAGGATCAGCGGTAAGCATGTCGACCTGTACAAGCTG 300


3274R-1.IR_full       301 TACAACGAGGTAACCGAACGAGGCGGCTTTAATAAGGTGACCATGCGGGACGAGTGGGAC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3274R-1.in silico     301 TACAACGAGGTAACCGAACGAGGCGGCTTTAATAAGGTGACCATGCGGGACGAGTGGGAC 360


3274R-1.IR_full       361 GAGGTGTACAGCGCCATGGAGACATTGCGGGAGCGCTGCGTTAACGGAACGGCTAGTATC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3274R-1.in silico     361 GAGGTGTACAGCGCCATGGAGACATTGCGGGAGCGCTGCGTTAACGGAACGGCTAGTATC 420


3274R-1.IR_full       421 AAGCACATCTACAGACGCTACCTGGACAAGTACGAACGGTTGAACTTCTTTGGCGAGGAT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3274R-1.in silico     421 AAGCACATCTACAGACGCTACCTGGACAAGTACGAACGGTTGAACTTCTTTGGCGAGGAT 480


3274R-1.IR_full       481 CCAGACAAGATGGAGGCTCTG 501
                          |||||||||||||||||||||
3274R-1.in silico     481 CCAGACAAGATGGAGGCTCTG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   483  NM_136372.2  CG3274-RA (Bap170), mRNA 
0   NM_080511.2  CG6440-RA (Dms), mRNA 
0   18  NM_141666.2  CG9492-RA (CG9492), mRNA 
0   NM_136409.1  CG17002-RB (CG17002), mRNA 
0   NM_079059.2  CG5519-RA (Gbp), mRNA 
0   13  NM_168103.1  CG7507-RB, transcript variant B (Dhc64C), mRNA 
0   12  NM_079205.3  CG7507-RA, transcript variant A (Dhc64C), mRNA 
0   NM_137076.1  CG6701-RA (CG6701), mRNA 
0   NM_001043013.1  CG17800-PBD (Dscam), mRNA 
0   NM_001014599.1  CG9390-RC, transcript variant C (AcCoAS), mRNA 
0   NM_168894.1  CG9390-RA, transcript variant A (AcCoAS), mRNA 
0   NM_079472.2  CG9390-RB, transcript variant B (AcCoAS), mRNA 
0   NM_168802.1  CG32210-RA (CG32210), mRNA 
0   NM_132193.1  CG1514-RA (CG1514), mRNA 
0   NM_141220.1  CG9783-RA (CG9783), mRNA 
0   NM_137339.2  CG9646-RA (CG9646), mRNA 
0   NM_132794.2  CG18210-RA (CG18210), mRNA 
0   NM_206153.1  CG33130-RC, transcript variant C (l(2)k07433), mRNA 
0   NM_176218.1  CG33130-RA, transcript variant A (l(2)k07433), mRNA 
0   NM_206154.1  CG33130-RB, transcript variant B (l(2)k07433), mRNA 
0   NM_138036.2  CG3209-RA, transcript variant A (CG3209), mRNA 
0   NM_166658.1  CG3209-RB, transcript variant B (CG3209), mRNA 
0   11  NM_140329.2  CG4107-RA (Pcaf), mRNA 
0   NM_141444.1  CG10061-RA (l(3)s2214), mRNA 
0   NM_133101.2  CG7101-RA (CG7101), mRNA 
0   NM_079315.2  CG10436-RA (Pbprp1), mRNA 
0   NM_131971.2  CG4068-RA, transcript variant A (CG4068), mRNA 
0   NM_206627.1  CG4068-RB, transcript variant B (CG4068), mRNA 
0   NM_169145.1  CG15186-RB, transcript variant B (CG15186), mRNA 
0   NM_206436.1  CG15186-RC, transcript variant C (CG15186), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.