National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3273R-3 
 Symbol sced  Full Name scrambled 
 CG No CG3273  Old CG No CG3273 
 Synonyms CT9143, CG3273, sced 
 Accession No (Link to NCBI) NM_136375.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees male lethal 
 Map Viewer
 Reference
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTAGCGCTCTCTCTCCGCGAGT 
 Primer Seq. 3'
aatctagaggtaccCATGGTTCTGGGCCTCGAAGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TAGCGCTCTC TCTCCGCGAG TCTcGCAAAT ATACGAGGAG ATTTTTGACG GCAGCCGCAT 
0061 CTCCCGCGTC TCAATCGCAT CCGGCATTTA CGAAGAGATG AAGCCGTCAG TCATGGAGAC 
0121 TCCTTCACCG CCACCGCTGC CCGCACATCC TTACCGTCAG CGAATAAACA CTTTTGAGTG 
0181 CGCCCAGCTT GGCGAGATTG CGCGGTCCAG CACCAATCCC GAATCGGAGC TGGCCAAGAA 
0241 GAAGAAATAC AAGAACATGC TGGACAACCT GTTCGGGAGT TCACGTCAAA AGCGTTCCGG 
0301 CAGCACCAGC GAGGTGGCCA ATGAACCCAG CGATGAGGTC CTGCCACTGT ATGAGAATGC 
0361 CCCCACGcCG GAGCCTGTGC TTCCGGTAAA GCGCACATCC CAGTTGAACA AGTCTCAGCG 
0421 TAATAGCTTC TCAAGTCCGG ACTTGTCCAA ACTCAATCTG CTGGACACCT TTGGAGAATA 
0481 CTTCGAGGCC CAGaACCATG  
 in silico PCR Fragment
0001 TAGCGCTCTC TCTCCGCGAG TCTCGCAAAT ATACGAGGAG ATTTTTGACG GCAGCCGCAT 
0061 CTCCCGCGTC TCAATCGCAT CCGGCATTTA CGAAGAGATG AAGCCGTCAG TCATGGAGAC 
0121 TCCTTCACCG CCACCGCTGC CCGCACATCC TTACCGTCAG CGAATAAACA CTTTTGAGTG 
0181 CGCCCAGCTT GGCGAGATTG CGCGGTCCAG CACCAATCCC GAATCGGAGC TGGCCAAGAA 
0241 GAAGAAATAC AAGAACATGC TGGACAACCT GTTCGGGAGT TCACGTCAAA AGCGTTCCGG 
0301 CAGCACCAGC GAGGTGGCCA ATGAACCCAG CGATGAGGTC CTGCCACTGT ATGAGAATGC 
0361 CCCCACGCCG GAGCCTGTGC TTCCGGTAAA GCGCACATCC CAGTTGAACA AGTCTCAGCG 
0421 TAATAGCTTC TCAAGTCCGG ACTTGTCCAA ACTCAATCTG CTGGACACCT TTGGAGAATA 
0481 CTTCGAGGCC CAGAACCATG  
 Assemble Data

3273R-3.IR_full       1   TAGCGCTCTCTCTCCGCGAGTCTCGCAAATATACGAGGAGATTTTTGACGGCAGCCGCAT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3273R-3.in silico     1   TAGCGCTCTCTCTCCGCGAGTCTCGCAAATATACGAGGAGATTTTTGACGGCAGCCGCAT 60


3273R-3.IR_full       61  CTCCCGCGTCTCAATCGCATCCGGCATTTACGAAGAGATGAAGCCGTCAGTCATGGAGAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3273R-3.in silico     61  CTCCCGCGTCTCAATCGCATCCGGCATTTACGAAGAGATGAAGCCGTCAGTCATGGAGAC 120


3273R-3.IR_full       121 TCCTTCACCGCCACCGCTGCCCGCACATCCTTACCGTCAGCGAATAAACACTTTTGAGTG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3273R-3.in silico     121 TCCTTCACCGCCACCGCTGCCCGCACATCCTTACCGTCAGCGAATAAACACTTTTGAGTG 180


3273R-3.IR_full       181 CGCCCAGCTTGGCGAGATTGCGCGGTCCAGCACCAATCCCGAATCGGAGCTGGCCAAGAA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3273R-3.in silico     181 CGCCCAGCTTGGCGAGATTGCGCGGTCCAGCACCAATCCCGAATCGGAGCTGGCCAAGAA 240


3273R-3.IR_full       241 GAAGAAATACAAGAACATGCTGGACAACCTGTTCGGGAGTTCACGTCAAAAGCGTTCCGG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3273R-3.in silico     241 GAAGAAATACAAGAACATGCTGGACAACCTGTTCGGGAGTTCACGTCAAAAGCGTTCCGG 300


3273R-3.IR_full       301 CAGCACCAGCGAGGTGGCCAATGAACCCAGCGATGAGGTCCTGCCACTGTATGAGAATGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3273R-3.in silico     301 CAGCACCAGCGAGGTGGCCAATGAACCCAGCGATGAGGTCCTGCCACTGTATGAGAATGC 360


3273R-3.IR_full       361 CCCCACGCCGGAGCCTGTGCTTCCGGTAAAGCGCACATCCCAGTTGAACAAGTCTCAGCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3273R-3.in silico     361 CCCCACGCCGGAGCCTGTGCTTCCGGTAAAGCGCACATCCCAGTTGAACAAGTCTCAGCG 420


3273R-3.IR_full       421 TAATAGCTTCTCAAGTCCGGACTTGTCCAAACTCAATCTGCTGGACACCTTTGGAGAATA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3273R-3.in silico     421 TAATAGCTTCTCAAGTCCGGACTTGTCCAAACTCAATCTGCTGGACACCTTTGGAGAATA 480


3273R-3.IR_full       481 CTTCGAGGCCCAGAACCATG 500
                          ||||||||||||||||||||
3273R-3.in silico     481 CTTCGAGGCCCAGAACCATG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136375.1  CG3273-RA (sced), mRNA 
0   NM_058007.3  CG1071-RA (E2f2), mRNA 
0   NM_136635.2  CG2078-RA (Myd88), mRNA 
0   NM_140521.1  CG6498-RA (CG6498), mRNA 
0   NM_142392.2  CG12334-RA (Atg8b), mRNA 
0   NM_141474.2  CG2616-RA (CG2616), mRNA 
0   11  NM_001042820.1  CG34145-RA (CG34145), mRNA 
0   13  NM_078523.2  CG2252-RB, transcript variant B (fs(1)h), mRNA 
0   NM_134519.1  CG11940-RA, transcript variant A (CG11940), mRNA 
0   NM_167686.1  CG11940-RB, transcript variant B (CG11940), mRNA 
0   NM_132652.2  CG1987-RA (Rbp1-like), mRNA 
0   NM_167189.2  CG32705-RA (CG32705), mRNA 
0   NM_130614.2  CG4322-RA (CG4322), mRNA 
0   NM_167676.1  CG12529-RB, transcript variant B (Zw), mRNA 
0   NM_078687.1  CG12529-RA, transcript variant A (Zw), mRNA 
0   NM_134714.3  CG4341-RA (CG4341), mRNA 
0   NM_136602.3  CG8083-RA, transcript variant A (CG8083), mRNA 
0   NM_206060.1  CG8083-RB, transcript variant B (CG8083), mRNA 
0   NM_206059.1  CG8083-RC, transcript variant C (CG8083), mRNA 
0   NM_078659.3  CG5055-RA, transcript variant A (baz), mRNA 
0   NM_001042818.1  CG5055-RB, transcript variant B (baz), mRNA 
0   NM_078520.2  CG2212-RA, transcript variant A (sws), mRNA 
0   NM_142350.1  CG11896-RA (CG11896), mRNA 
0   NM_141281.2  CG2087-RA (PEK), mRNA 
0   NM_141429.2  CG1984-RA (djl), mRNA 
0   NM_001042994.1  CG17082-RE, transcript variant E (CG17082), mRNA 
0   NM_137882.1  CG13531-RB (CG13531), mRNA 
0   NM_001042993.1  CG17082-RB, transcript variant B (CG17082), mRNA 
0   NM_140250.1  CG5964-RA (CG5964), mRNA 
0   NM_135795.1  CG9395-RA (CG9395), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.