National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3265R-1 
 Symbol Eb1  Full Name Eb1 
 CG No CG3265  Old CG No CG3265 
 Synonyms EB1, Dm EB1, CG3265, dEB1, S(DmcycE[JP])2.5, dEb1, EB-1, dEB-1, l(2)04524, BcDNA.LD08743, l(2)4524, clone 2.52, clone 2.33, anon-EST:Liang-2.52, anon-EST:Liang-2.33, BcDNA:LD08743, Eb1, DmEB1 
 Accession No (Link to NCBI) NM_165488.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGCTGTAAACGTCTACTCC 
 Primer Seq. 3'
aatctagaggtaccTTGCCGATGGGCCACGTCGAT 
 Predicted Fragment Size
490 
 IR fragment full Seq
0001 ATGGCTGTAA ACGTCTACTC CACAAATGTG ACGTCAGAGA ATCTCTCGCG CCACGATATG 
0061 CTAGCTTGGG TTAACGATTG CCTCCAGTCG CAATTCTCAA AAATCGAGGA GCTCTGCACA 
0121 GGTGCAGCTT ACTGTCAGTT CATGGACATG CTGTTTCCCA ATTCAGTGCC AGTAAAGCGT 
0181 GTCAAATTTC GTACCAATCT GGAGCACGAG TACATACAGA ACTTCAAGAT ATTGCAGGCG 
0241 GGCTTCAAGA AGATGTCTGT GGATAAGATT ATACCCATTG ACAAATTAGT CAAGGGTCGC 
0301 TTCCAAGACA ATTTCGAGTT TTTGCAATGG TTTAAAAAGT TCTTCGATGC CAATTACGAT 
0361 GGCAGGGATT ACGATGCCAG CGCGGTGCGC GAGGGAGCCC CAATGGGCTT CGGATCGGGA 
0421 GCGGTAAAGT CACTGCCCGG CACGGCGGCA AGCGGCGTGT CCAGCAGCTA TCGACGTGGC 
0481 CCATCGGCAA  
 in silico PCR Fragment
0001 ATGGCTGTAA ACGTCTACTC CACAAATGTG ACGTCAGAGA ATCTCTCGCG CCACGATATG 
0061 CTAGCTTGGG TTAACGATTG CCTCCAGTCG CAATTCTCAA AAATCGAGGA GCTCTGCACA 
0121 GGTGCAGCTT ACTGTCAGTT CATGGACATG CTGTTTCCCA ATTCAGTGCC AGTAAAGCGT 
0181 GTCAAATTTC GTACCAATCT GGAGCACGAG TACATACAGA ACTTCAAGAT ATTGCAGGCG 
0241 GGCTTCAAGA AGATGTCTGT GGATAAGATT ATACCCATTG ACAAATTAGT CAAGGGTCGC 
0301 TTCCAAGACA ATTTCGAGTT TTTGCAATGG TTTAAAAAGT TCTTCGATGC CAATTACGAT 
0361 GGCAGGGATT ACGATGCCAG CGCGGTGCGC GAGGGAGCCC CAATGGGCTT CGGATCGGGA 
0421 GCGGTAAAGT CACTGCCCGG CACGGCGGCA AGCGGCGTGT CCAGCAGCTA TCGACGTGGC 
0481 CCATCGGCAA  
 Assemble Data

3265R-1.IR_full       1   ATGGCTGTAAACGTCTACTCCACAAATGTGACGTCAGAGAATCTCTCGCGCCACGATATG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3265R-1.in silico     1   ATGGCTGTAAACGTCTACTCCACAAATGTGACGTCAGAGAATCTCTCGCGCCACGATATG 60


3265R-1.IR_full       61  CTAGCTTGGGTTAACGATTGCCTCCAGTCGCAATTCTCAAAAATCGAGGAGCTCTGCACA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3265R-1.in silico     61  CTAGCTTGGGTTAACGATTGCCTCCAGTCGCAATTCTCAAAAATCGAGGAGCTCTGCACA 120


3265R-1.IR_full       121 GGTGCAGCTTACTGTCAGTTCATGGACATGCTGTTTCCCAATTCAGTGCCAGTAAAGCGT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3265R-1.in silico     121 GGTGCAGCTTACTGTCAGTTCATGGACATGCTGTTTCCCAATTCAGTGCCAGTAAAGCGT 180


3265R-1.IR_full       181 GTCAAATTTCGTACCAATCTGGAGCACGAGTACATACAGAACTTCAAGATATTGCAGGCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3265R-1.in silico     181 GTCAAATTTCGTACCAATCTGGAGCACGAGTACATACAGAACTTCAAGATATTGCAGGCG 240


3265R-1.IR_full       241 GGCTTCAAGAAGATGTCTGTGGATAAGATTATACCCATTGACAAATTAGTCAAGGGTCGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3265R-1.in silico     241 GGCTTCAAGAAGATGTCTGTGGATAAGATTATACCCATTGACAAATTAGTCAAGGGTCGC 300


3265R-1.IR_full       301 TTCCAAGACAATTTCGAGTTTTTGCAATGGTTTAAAAAGTTCTTCGATGCCAATTACGAT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3265R-1.in silico     301 TTCCAAGACAATTTCGAGTTTTTGCAATGGTTTAAAAAGTTCTTCGATGCCAATTACGAT 360


3265R-1.IR_full       361 GGCAGGGATTACGATGCCAGCGCGGTGCGCGAGGGAGCCCCAATGGGCTTCGGATCGGGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3265R-1.in silico     361 GGCAGGGATTACGATGCCAGCGCGGTGCGCGAGGGAGCCCCAATGGGCTTCGGATCGGGA 420


3265R-1.IR_full       421 GCGGTAAAGTCACTGCCCGGCACGGCGGCAAGCGGCGTGTCCAGCAGCTATCGACGTGGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3265R-1.in silico     421 GCGGTAAAGTCACTGCCCGGCACGGCGGCAAGCGGCGTGTCCAGCAGCTATCGACGTGGC 480


3265R-1.IR_full       481 CCATCGGCAA 490
                          ||||||||||
3265R-1.in silico     481 CCATCGGCAA 490

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   472  NM_136389.3  CG3265-RB, transcript variant B (Eb1), mRNA 
100   472  NM_206030.1  CG3265-RE, transcript variant E (Eb1), mRNA 
100   472  NM_165489.1  CG3265-RD, transcript variant D (Eb1), mRNA 
100   472  NM_165488.1  CG3265-RA, transcript variant A (Eb1), mRNA 
96.82   457  11  22  21  NM_165487.2  CG3265-RC, transcript variant C (Eb1), mRNA 
45.12   213  108  31  27  NM_001015226.1  CG40354-PA.3 (CG40354), mRNA 
36.01   170  109  46  31  NM_001015225.1  CG40354-PB.3 (CG40354), mRNA 
0   37  NM_137540.1  CG18190-RA (CG18190), mRNA 
0   13  32  NM_168231.1  CG32371-RA (CG32371), mRNA 
0   NM_142897.1  CG10168-RA (CG10168), mRNA 
0   NM_141073.1  CG7173-RA (CG7173), mRNA 
0   NM_130492.2  CG13366-RA, transcript variant A (CG13366), mRNA 
0   NM_001042789.1  CG13366-RB, transcript variant B (CG13366), mRNA 
0   NM_001043297.1  CG3339-RB, transcript variant B (CG3339), mRNA 
0   NM_143300.1  CG3339-RA, transcript variant A (CG3339), mRNA 
0   NM_137583.3  CG11228-RA (hpo), mRNA 
0   NM_167399.4  CG12047-RB, transcript variant B (mud), mRNA 
0   NM_167400.3  CG12047-RA, transcript variant A (mud), mRNA 
0   NM_080495.3  CG12047-RC, transcript variant C (mud), mRNA 
0   NM_057597.2  CG10719-RA, transcript variant A (brat), mRNA 
0   NM_134302.1  CG10719-RB, transcript variant B (brat), mRNA 
0   NM_206004.1  CG10719-RC, transcript variant C (brat), mRNA 
0   NM_133150.2  CG8062-RA (CG8062), mRNA 
0   NM_141590.2  CG11964-RA (CG11964), mRNA 
0   NM_139836.2  CG8610-RA (Cdc27), mRNA 
0   NM_139560.2  CG14971-RA (CG14971), mRNA 
0   NM_001038900.1  CG11583-RA (CG11583), mRNA 
0   NM_130605.3  CG3806-RA, transcript variant A (eIF2B-epsilon), mRNA 
0   NM_206606.1  CG3806-RB, transcript variant B (eIF2B-epsilon), mRNA 
0   NM_079509.1  CG2666-RA, transcript variant A (kkv), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.