National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3260R-6 
 Symbol Zfrp8  Full Name Zinc finger protein RP-8 
 CG No CG3260  Old CG No CG3260 
 Synonyms CG3260, zfrp8, 137/5, l(2)k13705, Zfrp8, PDCD2 
 Accession No (Link to NCBI) NM_138046.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCGCAGCTGCAGTGCAGCAAG 
 Primer Seq. 3'
aatctagaggtaccAACTCCGCCAAGCGAGCCTCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCGCAGCTGC AGTGCAGCAA GTGCAGGGCA CCCAAATCCT TCCTGGCTCA GCTATACGCT 
0061 CCCTTCGAAG ACGAGTACAA CTTTCATCGG TCCATCTATG TGTTCCTGTG CCGGAATTCC 
0121 GACTGCCAGG AGGCCCAAAA TGCAAGCAAT TTCACAGTCC TCAGGTCACA GTTGCCGCGA 
0181 AAAAATAAGT TCTTTTCGGA GGAGGAGCCG AGCGACGTNG GGTCAACCCC TGCCCGCCGT 
0241 TCCCTGCCTA AAGAAACTAT GCGCCGCCTG CGGTTGCCAT GCTCCTCACG CCTGCAGCAA 
0301 ATGCAAGGCA ATCCACTACT GCTCACCAGA GCATCAAAGG GCCCACTGGC CACAACACAA 
0361 GCCAAACTGC GGAGCACCAG AAGTAGCCAC TGAGAAGCCC TTAACACAAA TCGTTTTCCC 
0421 AGAATTTGAG ATTGTAATGG ACAGCAACCC CGTGGAGTCT GGCGAGGAGG ACAAGGACGA 
0481 TGAGGCTCGC TTGGCGGAGT T 
 in silico PCR Fragment
0001 TCGCAGCTGC AGTGCAGCAA GTGCAGGGCA CCCAAATCCT TCCTGGCTCA GCTATACGCT 
0061 CCCTTCGAAG ACGAGTACAA CTTTCATCGG TCCATCTATG TGTTCCTGTG CCGGAATTCC 
0121 GACTGCCAGG AGGCCCAAAA TGCAAGCAAT TTCACAGTCC TCAGGTCACA GTTGCCGCGA 
0181 AAAAATAAGT TCTTTTCGGA GGAGGAGCCG AGCGACGT-G GGTCAACCCC TGCCCGCCGT 
0241 TCCCTGCCTA AAGAAACTAT GCGCCGCCTG CGGTTGCCAT GCTCCTCACG CCTGCAGCAA 
0301 ATGCAAGGCA ATCCACTACT GCTCACCAGA GCATCAAAGG GCCCACTGGC CACAACACAA 
0361 GCCAAACTGC GGAGCACCAG AAGTAGCCAC TGAGAAGCCC TTAACACAAA TCGTTTTCCC 
0421 AGAATTTGAG ATTGTAATGG ACAGCAACCC CGTGGAGTCT GGCGAGGAGG ACAAGGACGA 
0481 TGAGGCTCGC TTGGCGGAGT T 
 Assemble Data

3260R-6.IR_full       1   TCGCAGCTGCAGTGCAGCAAGTGCAGGGCACCCAAATCCTTCCTGGCTCAGCTATACGCT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3260R-6.in silico     1   TCGCAGCTGCAGTGCAGCAAGTGCAGGGCACCCAAATCCTTCCTGGCTCAGCTATACGCT 60


3260R-6.IR_full       61  CCCTTCGAAGACGAGTACAACTTTCATCGGTCCATCTATGTGTTCCTGTGCCGGAATTCC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3260R-6.in silico     61  CCCTTCGAAGACGAGTACAACTTTCATCGGTCCATCTATGTGTTCCTGTGCCGGAATTCC 120


3260R-6.IR_full       121 GACTGCCAGGAGGCCCAAAATGCAAGCAATTTCACAGTCCTCAGGTCACAGTTGCCGCGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3260R-6.in silico     121 GACTGCCAGGAGGCCCAAAATGCAAGCAATTTCACAGTCCTCAGGTCACAGTTGCCGCGA 180


3260R-6.IR_full       181 AAAAATAAGTTCTTTTCGGAGGAGGAGCCGAGCGACGTNGGGTCAACCCCTGCCCGCCGT 240
                          |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
3260R-6.in silico     181 AAAAATAAGTTCTTTTCGGAGGAGGAGCCGAGCGACGT-GGGTCAACCCCTGCCCGCCGT 240


3260R-6.IR_full       241 TCCCTGCCTAAAGAAACTATGCGCCGCCTGCGGTTGCCATGCTCCTCACGCCTGCAGCAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3260R-6.in silico     241 TCCCTGCCTAAAGAAACTATGCGCCGCCTGCGGTTGCCATGCTCCTCACGCCTGCAGCAA 300


3260R-6.IR_full       301 ATGCAAGGCAATCCACTACTGCTCACCAGAGCATCAAAGGGCCCACTGGCCACAACACAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3260R-6.in silico     301 ATGCAAGGCAATCCACTACTGCTCACCAGAGCATCAAAGGGCCCACTGGCCACAACACAA 360


3260R-6.IR_full       361 GCCAAACTGCGGAGCACCAGAAGTAGCCACTGAGAAGCCCTTAACACAAATCGTTTTCCC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3260R-6.in silico     361 GCCAAACTGCGGAGCACCAGAAGTAGCCACTGAGAAGCCCTTAACACAAATCGTTTTCCC 420


3260R-6.IR_full       421 AGAATTTGAGATTGTAATGGACAGCAACCCCGTGGAGTCTGGCGAGGAGGACAAGGACGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3260R-6.in silico     421 AGAATTTGAGATTGTAATGGACAGCAACCCCGTGGAGTCTGGCGAGGAGGACAAGGACGA 480


3260R-6.IR_full       481 TGAGGCTCGCTTGGCGGAGTT 501
                          |||||||||||||||||||||
3260R-6.in silico     481 TGAGGCTCGCTTGGCGGAGTT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_138046.1  CG3260-RA (Zfrp8), mRNA 
0.62   NM_135247.2  CG9138-RA (SP1070), mRNA 
0   NM_079033.2  CG8421-RB, transcript variant B (Asph), mRNA 
0   NM_166140.1  CG8421-RA, transcript variant A (Asph), mRNA 
0   NM_166141.2  CG8421-RD, transcript variant D (Asph), mRNA 
0   NM_078656.3  CG9108-RA (RSG7), mRNA 
0   NM_132227.1  CG15337-RA (CG15337), mRNA 
0   NM_132032.1  CG15769-RA (CG15769), mRNA 
0   NM_001014481.1  CG7147-RC, transcript variant C (kuz), mRNA 
0   NM_165047.1  CG7147-RB, transcript variant B (kuz), mRNA 
0   NM_057839.3  CG7147-RA, transcript variant A (kuz), mRNA 
0   NM_079395.2  CG9695-RA (Dab), mRNA 
0   NM_141964.2  CG6225-RA (CG6225), mRNA 
0   NM_140697.2  CG7853-RA (CG7853), mRNA 
0   NM_132200.1  CG1531-RB (CG1531), mRNA 
0   NM_079056.2  CG5784-RB, transcript variant B (Mapmodulin), mRNA 
0   NM_166258.1  CG5784-RA, transcript variant A (Mapmodulin), mRNA 
0   NM_136003.2  CG6412-RA (CG6412), mRNA 
0   NM_143282.2  CG5880-RA (CG5880), mRNA 
0   NM_169384.2  CG31386-RA (CG31386), mRNA 
0   NM_080047.2  CG8491-RA (kto), mRNA 
0   NM_134957.1  CG3604-RA (CG3604), mRNA 
0   NM_080161.1  CG3496-RA (vir), mRNA 
0   NM_139987.2  CG6372-RA (CG6372), mRNA 
0   NM_132228.2  CG10761-RA (CG10761), mRNA 
0   NM_135770.2  CG15482-RA (CG15482), mRNA 
0   NM_166232.1  CG30104-RB, transcript variant B (CG30104), mRNA 
0   NM_137374.2  CG30104-RA, transcript variant A (CG30104), mRNA 
0   10  NM_135651.2  CG4751-RA (CG4751), mRNA 
0   NM_080516.1  CG16757-RA (Spn), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.