National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32483R-1 
 Symbol CG32483  Full Name CG32483 
 CG No CG32483  Old CG No CG32483 
 Synonyms CG32483 
 Accession No (Link to NCBI) NM_167839.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGAAGGGATTCTATACCCTGC 
 Primer Seq. 3'
aatctagaggtaccATCCTCCAGTAACTTGGTTCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGAAGGGATT CTATACCCTG CATCCAGAGT TCGAGGAGGT GCCGCTGCAT ATATTCTGCG 
0061 AGAGTTACGG TGGAAAGATG GCGCCGGAGT TTGCACTCGA ACTGTACTAC GCCAAGAAGC 
0121 GTGGTGAGGT CAAGAGCAAC CTTACCTCGG TGGCTTTGGG GGATCCATGG ACCTCGCCCA 
0181 TCGACTCCGT GCTCGCATGG GGACCTTTTC TCAGAGAAAT GGGAATCGTG GACCACGCGG 
0241 GATACAATGC CATTCAAGAG GCAGCGAACT TCACGGCTCA GTTGGTGGAG GAGGAGCGAT 
0301 GGATTCAGGC CACCTATCAG TGGGGCAACA CCCAGTGGGA GGTGATGAAA GCCTCCAAGG 
0361 GTGTGGACTT CTACAACGTG CTGAAGGAGA CAAAGGGTGG TCTCTACCAG AGATCAAAGG 
0421 CCTTGACCTC CGAAGAACGT CTGTATCGCA CCATGGTGAA ATACGATATT GATGAGGATC 
0481 GAACCAAGTT ACTGGAGGAT  
 in silico PCR Fragment
0001 TGAAGGGATT CTATACCCTG CATCCAGAGT TCGAGGAGGT GCCGCTGCAT ATATTCTGCG 
0061 AGAGTTACGG TGGAAAGATG GCGCCGGAGT TTGCACTCGA ACTGTACTAC GCCAAGAAGC 
0121 GTGGTGAGGT CAAGAGCAAC CTTACCTCGG TGGCTTTGGG GGATCCATGG ACCTCGCCCA 
0181 TCGACTCCGT GCTCGCATGG GGACCTTTTC TCAGAGAAAT GGGAATCGTG GACCACGCGG 
0241 GATACAATGC CATTCAAGAG GCAGCGAACT TCACGGCTCA GTTGGTGGAG GAGGAGCGAT 
0301 GGATTCAGGC CACCTATCAG TGGGGCAACA CCCAGTGGGA GGTGATGAAA GCCTCCAAGG 
0361 GTGTGGACTT CTACAACGTG CTGAAGGAGA CAAAGGGTGG TCTCTACCAG AGATCAAAGG 
0421 CCTTGACCTC CGAAGAACGT CTGTATCGCA CCATGGTGAA ATACGATATT GATGAGGATC 
0481 GAACCAAGTT ACTGGAGGAT  
 Assemble Data

32483R-1.IR_full       1   TGAAGGGATTCTATACCCTGCATCCAGAGTTCGAGGAGGTGCCGCTGCATATATTCTGCG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32483R-1.in silico     1   TGAAGGGATTCTATACCCTGCATCCAGAGTTCGAGGAGGTGCCGCTGCATATATTCTGCG 60


32483R-1.IR_full       61  AGAGTTACGGTGGAAAGATGGCGCCGGAGTTTGCACTCGAACTGTACTACGCCAAGAAGC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32483R-1.in silico     61  AGAGTTACGGTGGAAAGATGGCGCCGGAGTTTGCACTCGAACTGTACTACGCCAAGAAGC 120


32483R-1.IR_full       121 GTGGTGAGGTCAAGAGCAACCTTACCTCGGTGGCTTTGGGGGATCCATGGACCTCGCCCA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32483R-1.in silico     121 GTGGTGAGGTCAAGAGCAACCTTACCTCGGTGGCTTTGGGGGATCCATGGACCTCGCCCA 180


32483R-1.IR_full       181 TCGACTCCGTGCTCGCATGGGGACCTTTTCTCAGAGAAATGGGAATCGTGGACCACGCGG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32483R-1.in silico     181 TCGACTCCGTGCTCGCATGGGGACCTTTTCTCAGAGAAATGGGAATCGTGGACCACGCGG 240


32483R-1.IR_full       241 GATACAATGCCATTCAAGAGGCAGCGAACTTCACGGCTCAGTTGGTGGAGGAGGAGCGAT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32483R-1.in silico     241 GATACAATGCCATTCAAGAGGCAGCGAACTTCACGGCTCAGTTGGTGGAGGAGGAGCGAT 300


32483R-1.IR_full       301 GGATTCAGGCCACCTATCAGTGGGGCAACACCCAGTGGGAGGTGATGAAAGCCTCCAAGG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32483R-1.in silico     301 GGATTCAGGCCACCTATCAGTGGGGCAACACCCAGTGGGAGGTGATGAAAGCCTCCAAGG 360


32483R-1.IR_full       361 GTGTGGACTTCTACAACGTGCTGAAGGAGACAAAGGGTGGTCTCTACCAGAGATCAAAGG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32483R-1.in silico     361 GTGTGGACTTCTACAACGTGCTGAAGGAGACAAAGGGTGGTCTCTACCAGAGATCAAAGG 420


32483R-1.IR_full       421 CCTTGACCTCCGAAGAACGTCTGTATCGCACCATGGTGAAATACGATATTGATGAGGATC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32483R-1.in silico     421 CCTTGACCTCCGAAGAACGTCTGTATCGCACCATGGTGAAATACGATATTGATGAGGATC 480


32483R-1.IR_full       481 GAACCAAGTTACTGGAGGAT 500
                           ||||||||||||||||||||
32483R-1.in silico     481 GAACCAAGTTACTGGAGGAT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_167839.1  CG32483-RA (CG32483), mRNA 
0   NM_165138.1  CG31823-RA (CG31823), mRNA 
0   50  66  NM_138207.2  CG3344-RA (CG3344), mRNA 
0   NM_169742.1  CG3983-RA, transcript variant A (CG3983), mRNA 
0   NM_142336.1  CG3983-RB, transcript variant B (CG3983), mRNA 
0   NM_057656.2  CG12345-RA, transcript variant A (Cha), mRNA 
0   NM_206517.1  CG12345-RB, transcript variant B (Cha), mRNA 
0   NM_078564.2  CG1594-RA (hop), mRNA 
0   NM_078844.2  CG3688-RA (l(2)35Bd), mRNA 
0   NM_168482.1  CG32095-RA (CG32095), mRNA 
0   NM_143378.2  CG1523-RA (CG1523), mRNA 
0   NM_132819.2  CG8105-RA (CG8105), mRNA 
0   NM_176449.1  CG33208-RH, transcript variant H (MICAL), mRNA 
0   NM_176448.1  CG33208-RG, transcript variant G (MICAL), mRNA 
0   NM_176446.1  CG33208-RD, transcript variant D (MICAL), mRNA 
0   NM_176445.1  CG33208-RC, transcript variant C (MICAL), mRNA 
0   NM_176447.1  CG33208-RF, transcript variant F (MICAL), mRNA 
0   NM_130536.1  CG14625-RB (CG14625), mRNA 
0   NM_134872.1  CG3123-RA (CG3123), mRNA 
0   NM_135304.2  CG7154-RA (CG7154), mRNA 
0   NM_136616.3  CG8057-RA, transcript variant A (CG8057), mRNA 
0   NM_136373.2  CG3174-RA (Fmo-2), mRNA 
0   NM_078665.2  CG6352-RA (OdsH), mRNA 
0   NM_139704.1  CG10635-RA (CG10635), mRNA 
0   NM_133160.1  CG12233-RA, transcript variant A (l(1)G0156), mRNA 
0   NM_001015383.1  CG12567-PB.3 (CG12567), mRNA 
0   NM_167657.1  CG12233-RB, transcript variant B (l(1)G0156), mRNA 
0   NM_001015384.1  CG12567-PA.3 (CG12567), mRNA 
0   NM_139799.3  CG10107-RA, transcript variant A (CG10107), mRNA 
0   NM_206286.1  CG10107-RC, transcript variant C (CG10107), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.