National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32457R-2 
 Symbol CG32457  Full Name CG32457 
 CG No CG32457  Old CG No CG32457 
 Synonyms CG32457 
 Accession No (Link to NCBI) NM_168982.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees short abdomen 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGGTTGGCATTGGTAAAGAC 
 Primer Seq. 3'
aatctagaggtaccAGACGTACTCTTGGCTTCCAG 
 Predicted Fragment Size
433 
 IR fragment full Seq
0001 TGGGTTGGCA TTGGTAAAGG ACCACACCGA AAGAACTTCA CTCAGAATCG ATTTTTGAAG 
0061 ATGAGGTCGC TCTTAGGTCC AAGTCAAGTA AAGCTGATGC TCTGCTTACA AAAACTACAA 
0121 CAAAAGCGTC AGCATCAAAT TTATTCTTTA AAGTCATTAC AACAACCCGA CCACCTGTGA 
0181 CAATCAGGCA CGTTGTAGCC AAGTCAAAGG GTAAGGATCC AGAAAGAACT GACCTCCACC 
0241 GCAAGCACCT CACACACCAC AAACATCACT CAAAAAAACA AAAAAAAGAA TCCACATAAT 
0301 CGTGCCGAAG CGAATCGAAA CAAGGATCAT AGTCCCCATG ATCCCCACAA AAACCTGAAA 
0361 AGAAAGGCAG AGGCACTCCC TAAGTCAAAT CAGAATATAA ATGGCACTAC TTCTCTGGAA 
0421 GCCAAGAGTA CGTCT 
 in silico PCR Fragment
0001 TGGGTTGGCA TTGGTAAA-G ACCACACCGA AAGAACTTCA CTCAGAATCG ATTTTTGAAG 
0061 ATGACGTCGC TCTAAGGTCC AAGTCAAGTA AAGCTGATGC TCTGCTTACA AAAACTACAA 
0121 CAAAAGCGTC AGCATCAAAT TTATTCTTTA AAGTCATTAC AACAACCCGA CCACCTGTGA 
0181 CAATCAGGCG CGTTGTAGCC AAGTCAAAGG GTAAGGATCC AGAAAGAACT GACCTCCACC 
0241 GCAAGCACCT CACACATCAC AAACATCACT C-AAAAAACA AAAAAAAGAA TCCACATAAT 
0301 CGTGCCGAAG CGAATCGAAA CAAGGATCAT AGTCCCCATG ATCCCCACAA AAACCTGAAA 
0361 AGAAAGGCAG AGGCACTCCC TAAGTCAAAT CAGAATATAA ATGGCACTAC TTCTCTGGAA 
0421 GCCAAGAGTA CGTCT 
 Assemble Data

32457R-2.IR_full       1   TGGGTTGGCATTGGTAAAGGACCACACCGAAAGAACTTCACTCAGAATCGATTTTTGAAG 60
                           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
32457R-2.in silico     1   TGGGTTGGCATTGGTAAA-GACCACACCGAAAGAACTTCACTCAGAATCGATTTTTGAAG 60


32457R-2.IR_full       61  ATGAGGTCGCTCTTAGGTCCAAGTCAAGTAAAGCTGATGCTCTGCTTACAAAAACTACAA 120
                           |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||
32457R-2.in silico     61  ATGACGTCGCTCTAAGGTCCAAGTCAAGTAAAGCTGATGCTCTGCTTACAAAAACTACAA 120


32457R-2.IR_full       121 CAAAAGCGTCAGCATCAAATTTATTCTTTAAAGTCATTACAACAACCCGACCACCTGTGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32457R-2.in silico     121 CAAAAGCGTCAGCATCAAATTTATTCTTTAAAGTCATTACAACAACCCGACCACCTGTGA 180


32457R-2.IR_full       181 CAATCAGGCACGTTGTAGCCAAGTCAAAGGGTAAGGATCCAGAAAGAACTGACCTCCACC 240
                           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
32457R-2.in silico     181 CAATCAGGCGCGTTGTAGCCAAGTCAAAGGGTAAGGATCCAGAAAGAACTGACCTCCACC 240


32457R-2.IR_full       241 GCAAGCACCTCACACACCACAAACATCACTCAAAAAAACAAAAAAAAGAATCCACATAAT 300
                           |||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||
32457R-2.in silico     241 GCAAGCACCTCACACATCACAAACATCACTC-AAAAAACAAAAAAAAGAATCCACATAAT 300


32457R-2.IR_full       301 CGTGCCGAAGCGAATCGAAACAAGGATCATAGTCCCCATGATCCCCACAAAAACCTGAAA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32457R-2.in silico     301 CGTGCCGAAGCGAATCGAAACAAGGATCATAGTCCCCATGATCCCCACAAAAACCTGAAA 360


32457R-2.IR_full       361 AGAAAGGCAGAGGCACTCCCTAAGTCAAATCAGAATATAAATGGCACTACTTCTCTGGAA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32457R-2.in silico     361 AGAAAGGCAGAGGCACTCCCTAAGTCAAATCAGAATATAAATGGCACTACTTCTCTGGAA 420


32457R-2.IR_full       421 GCCAAGAGTACGTCT 435
                           |||||||||||||||
32457R-2.in silico     421 GCCAAGAGTACGTCT 435

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   415  NM_168982.1  CG32457-RA (CG32457), mRNA 
0.48   NM_141577.2  CG11776-RA (CG11776), mRNA 
0   15  NM_057511.3  CG3936-RA (N), mRNA 
0   NM_057439.2  CG2759-RA (w), mRNA 
0   NM_166055.1  CG10108-RA (phyl), mRNA 
0   NM_139598.2  CG14989-RB (CG14989), mRNA 
0   NM_057509.3  CG1956-RA (R), mRNA 
0   NM_079249.2  CG6964-RB, transcript variant B (Gug), mRNA 
0   NM_176300.1  CG6964-RC, transcript variant C (Gug), mRNA 
0   NM_145106.1  CG6964-RA, transcript variant A (Gug), mRNA 
0   NM_206303.1  CG6964-RD, transcript variant D (Gug), mRNA 
0   NM_137451.2  CG5742-RA (CG5742), mRNA 
0   11  NM_134786.4  CG7337-RA, transcript variant A (CG7337), mRNA 
0   NM_132449.1  CG1545-RA (CG1545), mRNA 
0   NM_166320.1  CG15109-RC, transcript variant C (CG15109), mRNA 
0   NM_137550.2  CG15109-RA, transcript variant A (CG15109), mRNA 
0   NM_166321.1  CG15109-RB, transcript variant B (CG15109), mRNA 
0   NM_001014534.1  CG15109-RD, transcript variant D (CG15109), mRNA 
0   NM_132394.2  CG17841-RA (CG17841), mRNA 
0   19  NM_167552.1  CG4928-RA, transcript variant A (CG4928), mRNA 
0   NM_132268.1  CG12772-RA (CG12772), mRNA 
0   17  NM_078536.3  CG12154-RA, transcript variant A (oc), mRNA 
0   17  NM_001014727.1  CG12154-RB, transcript variant B (oc), mRNA 
0   16  NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 
0   16  NM_131975.3  CG32767-RA, transcript variant A (CG32767), mRNA 
0   NM_132951.2  CG4928-RB, transcript variant B (CG4928), mRNA 
0   NM_001014632.1  CG31243-RG, transcript variant G (cpo), mRNA 
0   NM_078587.2  CG4353-RC, transcript variant C (hep), mRNA 
0   NM_167324.1  CG32653-RA (CG32653), mRNA 
0   NM_176121.1  CG33183-RC, transcript variant C (Hr46), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.