National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32423R-3 
 Symbol shep  Full Name alan shepard 
 CG No CG32423  Old CG No CG32423 
 Synonyms CG32423, anon-EST:Posey83, CG10668, cg10668, CG10649, CG10647, BcDNA:RH63980, BcDNA:LD40028, anon-WO0172774.41, anon-WO0118547.198, alan, shep, alan-shepard 
 Accession No (Link to NCBI) NM_168111.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAACCACGTACGGTCAGCGAGT 
 Primer Seq. 3'
aatctagaggtaccTTTCTTTGAAGTGGGGCGGCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AACCACGTAC GGTCAGCGAG TGCCGACggC AGCTCTCACC GAGCAACACC AACTCGAGCA 
0061 GCTCCTCGAA CACTGGCTCC CAGAGCGGCA CCCTGAGCAC CAGCCTGAGC AACACGACGA 
0121 ACACCAACAC GAACATGGGT CCCAACGGCA CGGTACAGAA TCAGAACCAA CAGGGCGGCG 
0181 AGCAGNTTGT CCAAGACAAA TCTCTACATT CGCGGTCTGC AGCAGGGCAC AACCGACAAG 
0241 GATCTAGTTA ATATGTGTGC ACAATACGGA ACAATTATAT CAACCAAGGC TATTTTAGAT 
0301 AAAACAACAA ACAAATGTAA AGGTTACGGC TTCGTCGACT TCGAGCAGCC AGCCTTCGCC 
0361 GAGTGCGCCG TAAAAGGATT GCAGGGGAAG GGCGTGCAAG CTCAGATGGC CAAACAACAG 
0421 GAACATGGAT CCCACAAATT TGTATATTGC AAATTTGCCG CCCCACTTCA AAGAAA 
 in silico PCR Fragment
0001 AACCACGTAC GGTCAGCGAG TGCCGACGGC AGC-CTCACC GAGCAACACC AACTCGAGCA 
0061 GCTCCTCGAA CACTGGCTCC CAGAGCGGCA CCCTGAGCAC CAGCCTGAGC AACACGACGA 
0121 ACACCAACAC GAACATGGGT CCCAACGGCA CGGTACAGAA TCAGAACCAA CAGGGCGGCG 
0181 AGCAG-TTGT CCAAGACAAA TCTCTACATT CGCGGTCTGC AGCAGGGCAC AACCGACAAG 
0241 GATCTAGTTA ATATGTGTGC ACAATACGGA ACAATTATAT CAACCAAGGC TATTTTAGAT 
0301 AAAACAACAA ACAAATGTAA AGGTTACGGC TTCGTCGACT TCGAGCAGCC AGCCTTCGCC 
0361 GAGTGCGCCG TAAAAGGATT GCAGGGGAAG GGCGTGCAAG CTCAGATGGC CAAACAACAG 
0421 GAACA-GGAT CCCACAAATT TGTATATTGC AAATTTGCCG CCCCACTTCA AAGAAA 
 Assemble Data

32423R-3.IR_full       1   AACCACGTACGGTCAGCGAGTGCCGACGGCAGCTCTCACCGAGCAACACCAACTCGAGCA 60
                           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
32423R-3.in silico     1   AACCACGTACGGTCAGCGAGTGCCGACGGCAGC-CTCACCGAGCAACACCAACTCGAGCA 60


32423R-3.IR_full       61  GCTCCTCGAACACTGGCTCCCAGAGCGGCACCCTGAGCACCAGCCTGAGCAACACGACGA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32423R-3.in silico     61  GCTCCTCGAACACTGGCTCCCAGAGCGGCACCCTGAGCACCAGCCTGAGCAACACGACGA 120


32423R-3.IR_full       121 ACACCAACACGAACATGGGTCCCAACGGCACGGTACAGAATCAGAACCAACAGGGCGGCG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32423R-3.in silico     121 ACACCAACACGAACATGGGTCCCAACGGCACGGTACAGAATCAGAACCAACAGGGCGGCG 180


32423R-3.IR_full       181 AGCAGNTTGTCCAAGACAAATCTCTACATTCGCGGTCTGCAGCAGGGCACAACCGACAAG 240
                           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
32423R-3.in silico     181 AGCAG-TTGTCCAAGACAAATCTCTACATTCGCGGTCTGCAGCAGGGCACAACCGACAAG 240


32423R-3.IR_full       241 GATCTAGTTAATATGTGTGCACAATACGGAACAATTATATCAACCAAGGCTATTTTAGAT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32423R-3.in silico     241 GATCTAGTTAATATGTGTGCACAATACGGAACAATTATATCAACCAAGGCTATTTTAGAT 300


32423R-3.IR_full       301 AAAACAACAAACAAATGTAAAGGTTACGGCTTCGTCGACTTCGAGCAGCCAGCCTTCGCC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32423R-3.in silico     301 AAAACAACAAACAAATGTAAAGGTTACGGCTTCGTCGACTTCGAGCAGCCAGCCTTCGCC 360


32423R-3.IR_full       361 GAGTGCGCCGTAAAAGGATTGCAGGGGAAGGGCGTGCAAGCTCAGATGGCCAAACAACAG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32423R-3.in silico     361 GAGTGCGCCGTAAAAGGATTGCAGGGGAAGGGCGTGCAAGCTCAGATGGCCAAACAACAG 420


32423R-3.IR_full       421 GAACATGGATCCCACAAATTTGTATATTGCAAATTTGCCGCCCCACTTCAAAGAAA 476
                           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
32423R-3.in silico     421 GAACA-GGATCCCACAAATTTGTATATTGCAAATTTGCCGCCCCACTTCAAAGAAA 476

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168113.2  CG32423-RD, transcript variant D (alan-shepard), mRNA 
100   482  NM_168112.1  CG32423-RB, transcript variant B (alan-shepard), mRNA 
86.09   415  11  NM_168111.3  CG32423-RA, transcript variant A (alan-shepard), mRNA 
84.64   408  13  NM_168114.2  CG32423-RC, transcript variant C (alan-shepard), mRNA 
0   NM_080367.2  CG3189-RA (Dpit47), mRNA 
0   30  NM_168560.1  CG32132-RA (CG32132), mRNA 
0   NM_078700.2  CG1849-RA (run), mRNA 
0   NM_168589.1  CG9238-RA, transcript variant A (CG9238), mRNA 
0   NM_140451.2  CG9238-RB, transcript variant B (CG9238), mRNA 
0   NM_058161.3  CG5595-RA (Sce), mRNA 
0   10  NM_164486.1  CG9885-RC, transcript variant C (dpp), mRNA 
0   NM_140752.1  CG5589-RA (CG5589), mRNA 
0   NM_079821.2  CG1954-RA (Pkc98E), mRNA 
0   NM_079176.1  CG12008-RA, transcript variant A (kst), mRNA 
0   NM_206266.1  CG12008-RB, transcript variant B (kst), mRNA 
0   NM_206265.1  CG12008-RC, transcript variant C (kst), mRNA 
0   NM_165225.1  CG7100-RB, transcript variant B (CadN), mRNA 
0   NM_165227.1  CG7100-RD, transcript variant D (CadN), mRNA 
0   NM_165229.1  CG7100-RA, transcript variant A (CadN), mRNA 
0   NM_165231.1  CG7100-RE, transcript variant E (CadN), mRNA 
0   NM_001032106.1  CG7100-RL, transcript variant L (CadN), mRNA 
0   NM_001032109.1  CG7100-RI, transcript variant I (CadN), mRNA 
0   NM_165230.1  CG7100-RG, transcript variant G (CadN), mRNA 
0   NM_001032107.1  CG7100-RK, transcript variant K (CadN), mRNA 
0   NM_165228.1  CG7100-RC, transcript variant C (CadN), mRNA 
0   NM_001032108.1  CG7100-RJ, transcript variant J (CadN), mRNA 
0   NM_175954.1  CG33123-RA (CG33123), mRNA 
0   NM_165226.1  CG7100-RF, transcript variant F (CadN), mRNA 
0   NM_165224.1  CG7100-RH, transcript variant H (CadN), mRNA 
0   NM_001043262.1  CG34157-RE, transcript variant E (Dys), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.