National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32383Ra-1 
 Symbol sphinx1  Full Name sphinx1 
 CG No CG32383  Old CG No CG32383 
 Synonyms SPH194, CG8555, sphinx1, CG32383 
 Accession No (Link to NCBI) NM_168214.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAAGAAGATCGTATAGGGGCT 
 Primer Seq. 3'
aatctagaggtaccCCGGATACACGCTTTATCCAC 
 Predicted Fragment Size
499 
 IR fragment full Seq
0001 CAAGAAGATC GTATAGGGGC TTTGACATTA TAAGGATCTA CAAGGAAAAC TTCCGCTTTC 
0061 ATTATGATAA TGACCATGTA ATTGCCCTGG TTAAGTGTCC CTACCAAAAG TTTGATCGTC 
0121 GAATGGATCG TGTTCGCGTT CCAGCTTATG ATACAAGATT CGAACGATAT GTGGGAAATA 
0181 TGACCATGGT CTGTGGCTAC GGAACCGAAA AACGACATGC TAAGCTGCCC GAATGGATGC 
0241 GTTGCATAGA AGTGGAGGTC ATGAATAACA CGGAGTGCGC CAAATACTAT ACTCCATTGA 
0301 AATGGTATGA GATGTGCACC TCCGGCGAGG GCTTTAAAGG AGTTTGTGAG GGCGACATTG 
0361 GTGGTGCGGT GGTCACAATG GGGCCGAATC CCACCTTTAT TGGCATCATA TGGCTCATGC 
0421 CCGAAAACTG CAGCATTGGA TATCCTTCGA NACACATACG CGTCAGCGAT CATATAAAGT 
0481 GGATANNNNG TNNNNNCGG 
 in silico PCR Fragment
0001 CAAGAAGATC GTATAGGGGC TTTGACATTA TAAGGATCTA CAAGGAAAAC TTCCGCTTTC 
0061 ATTATGATAA TGACCATGTA ATTGCCCTGG TTAAGTGTCC CTACCAAAAG TTTGATCGTC 
0121 GAATGGATCG TGTTCGCGTT CCAGCTTATG ATACAAGATT CGAACGATAC GTGGGAAATA 
0181 TGACCATGGT CTGTGGCTAC GGAACCGAAA AACGACATGC TAAGCTGCCC GAATGGATGC 
0241 GTTGCATAGA AGTGGAGGTC ATGAATAACA CGGAGTGCGC CAAATACTAT ACGCCATTGA 
0301 AATGGTATGA GATGTGCACC TCCGGCGAGG GTTTTAAAGG AGTTTGTGAG GGTGACATTG 
0361 GTGGTGCGGT GGTCACAATG GGGCCGAATC CAACCTTCAT TGGCATCATA TGGCTCATGC 
0421 CCGAAAACTG CAGCATTGGA TATCCTTCGG TACACATACG CGTCAGCGAT CATATAAAGT 
0481 GGATAAAGCG TGTATCCGG 
 Assemble Data

32383Ra-1.IR full       1   CAAGAAGATCGTATAGGGGCTTTGACATTATAAGGATCTACAAGGAAAACTTCCGCTTTC 60
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32383Ra-1.in silico     1   CAAGAAGATCGTATAGGGGCTTTGACATTATAAGGATCTACAAGGAAAACTTCCGCTTTC 60


32383Ra-1.IR full       61  ATTATGATAATGACCATGTAATTGCCCTGGTTAAGTGTCCCTACCAAAAGTTTGATCGTC 120
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32383Ra-1.in silico     61  ATTATGATAATGACCATGTAATTGCCCTGGTTAAGTGTCCCTACCAAAAGTTTGATCGTC 120


32383Ra-1.IR full       121 GAATGGATCGTGTTCGCGTTCCAGCTTATGATACAAGATTCGAACGATATGTGGGAAATA 180
                            ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
32383Ra-1.in silico     121 GAATGGATCGTGTTCGCGTTCCAGCTTATGATACAAGATTCGAACGATACGTGGGAAATA 180


32383Ra-1.IR full       181 TGACCATGGTCTGTGGCTACGGAACCGAAAAACGACATGCTAAGCTGCCCGAATGGATGC 240
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32383Ra-1.in silico     181 TGACCATGGTCTGTGGCTACGGAACCGAAAAACGACATGCTAAGCTGCCCGAATGGATGC 240


32383Ra-1.IR full       241 GTTGCATAGAAGTGGAGGTCATGAATAACACGGAGTGCGCCAAATACTATACTCCATTGA 300
                            |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
32383Ra-1.in silico     241 GTTGCATAGAAGTGGAGGTCATGAATAACACGGAGTGCGCCAAATACTATACGCCATTGA 300


32383Ra-1.IR full       301 AATGGTATGAGATGTGCACCTCCGGCGAGGGCTTTAAAGGAGTTTGTGAGGGCGACATTG 360
                            ||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||
32383Ra-1.in silico     301 AATGGTATGAGATGTGCACCTCCGGCGAGGGTTTTAAAGGAGTTTGTGAGGGTGACATTG 360


32383Ra-1.IR full       361 GTGGTGCGGTGGTCACAATGGGGCCGAATCCCACCTTTATTGGCATCATATGGCTCATGC 420
                            ||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||
32383Ra-1.in silico     361 GTGGTGCGGTGGTCACAATGGGGCCGAATCCAACCTTCATTGGCATCATATGGCTCATGC 420


32383Ra-1.IR full       421 CCGAAAACTGCAGCATTGGATATCCTTCGANACACATACGCGTCAGCGATCATATAAAGT 480
                            |||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||
32383Ra-1.in silico     421 CCGAAAACTGCAGCATTGGATATCCTTCGGTACACATACGCGTCAGCGATCATATAAAGT 480


32383Ra-1.IR full       481 GGATANNNNGTNNNNNCGG 499
                            |||||    ||     |||
32383Ra-1.in silico     481 GGATAAAGCGTGTATCCGG 499

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   481  NM_168214.1  CG32383-RA (CG32383), mRNA 
20.99   101  149  56  82  NM_168215.1  CG32382-RA (CG32382), mRNA 
0   NM_144350.1  CG7487-RA (RecQ4), mRNA 
0   NM_001042868.1  CG34124-RA (CG34124), mRNA 
0   NM_140292.2  CG11534-RA (CG11534), mRNA 
0   NM_141070.2  CG7625-RA (VhaM9.7-2), mRNA 
0   NM_140830.1  CG14080-RB, transcript variant B (Mkp3), mRNA 
0   NM_140382.1  CG10171-RA, transcript variant A (CG10171), mRNA 
0   NM_168542.1  CG10171-RB, transcript variant B (CG10171), mRNA 
0   NM_140260.1  CG14129-RA (CG14129), mRNA 
0   NM_001038734.1  CG16902-RC (Hr4), mRNA 
0   NM_143397.2  CG1442-RA (eIF4E-6), mRNA 
0   NM_079985.2  CG5206-RA (bon), mRNA 
0   NM_168637.1  CG32151-RA (CG32151), mRNA 
0   NM_132546.2  CG1492-RA (CG1492), mRNA 
0   NM_140561.3  CG5931-RA (CG5931), mRNA 
0   NM_169429.3  CG14723-RA, transcript variant A (HisCl1), mRNA 
0   NM_141859.3  CG14723-RB, transcript variant B (HisCl1), mRNA 
0   NM_206474.1  CG14723-RC, transcript variant C (HisCl1), mRNA 
0   NM_168126.1  CG5406-RB, transcript variant B (sif), mRNA 
0   NM_137815.2  CG3380-RA (Oatp58Dc), mRNA 
0   NM_001038963.1  CG14372-RB (CG14372), mRNA 
0   NM_130671.2  CG2713-RA (CG2713), mRNA 
0   NM_132328.1  CG17446-RA (CG17446), mRNA 
0   NM_139462.1  CG13800-RA (CG13800), mRNA 
0   NM_001014623.1  CG33555-RD, transcript variant D (btsz), mRNA 
0   NM_001014624.1  CG33555-RC, transcript variant C (btsz), mRNA 
0   NM_132423.1  CG11556-RA (Rph), mRNA 
0   NM_078751.3  CG3047-RA (Sgs1), mRNA 
0   NM_134690.2  CG2807-RA (CG2807), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.