National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32341R-2 
 Symbol CG32341  Full Name CG32341 
 CG No CG32341  Old CG No CG32341 
 Synonyms BcDNA:SD01284, CG32341 
 Accession No (Link to NCBI) NM_167841.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CGAAATTGTGCACGTGCAAAGCCAGGACACGGTCGGCAATCGGAGGACGAGACGGTCGAG 60

                           ||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| silico     61  ATGGATGAGTGAGTTCCCGGCCGAGGA-CTCGGCGCTCGGCGCTCGGAACAACCCCCAAA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AGCAAATGTTGGGGTGTGTCGGAGTTAACGAGTTCAAATGTATTCATGAGCCGGATCTTA 180

                           |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| silico     181 CCAGCCAGCTGGCTGC-TATGTGGGAGGTGTCGCATGGGGGAGCCCCAGCCCGCTGCCAA 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AGTCCTCCCCCTCTCGAGGATTTGGCTTCCTGCCAGCTGCGAGGGTTGCCTGTGCCTGTG 300

                           |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ACTGTT-CCGTTGCCTTTGCAACCCGACTTTCCTGACTTATTGCCTCGCGGTCATGTGGG 360

                           ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| silico     361 AGGATGTGGCTCGGC-TAAAAGGCCCTCCTCCACTCAATGTTTTGCAATTTGCAGGTGTT 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TTCATCATCAATTTCGACCAGCTGTAGACATTTTTGAACAAGCCAACAGGCTCAGGGCAA 480

32341R-2.IR_full       481 TACATTC 487
                           ||||||| silico     481 TACATTC 487

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   465  NM_167841.1  CG32341-RA (CG32341), mRNA 
0   NM_141372.1  CG15593-RB, transcript variant B (Osi10), mRNA 
0   NM_169131.1  CG15593-RA, transcript variant A (Osi10), mRNA 
0   NM_133125.2  CG7537-RB (inx5), mRNA 
0   NM_176694.1  CG3126-RB, transcript variant B (C3G), mRNA 
0   NM_132122.2  CG3126-RA, transcript variant A (C3G), mRNA 
0   NM_165760.2  CG18408-RB, transcript variant B (CAP), mRNA 
0   NM_080317.2  CG2647-RA (per), mRNA 
0   10  NM_001043139.1  CG11282-RC, transcript variant C (caps), mRNA 
0   10  NM_079332.2  CG11282-RA, transcript variant A (caps), mRNA 
0   10  NM_168540.1  CG11282-RB, transcript variant B (caps), mRNA 
0   NM_080325.3  CG6450-RC (lva), mRNA 
0   NM_139582.1  CG12766-RA (CG12766), mRNA 
0   NM_137093.4  CG30069-RA (CG30069), mRNA 
0   NM_141097.2  CG14569-RA (CG14569), mRNA 
0   NM_133043.2  CG5744-RB, transcript variant B (Frq1), mRNA 
0   NM_001038764.1  CG5744-RC, transcript variant C (Frq1), mRNA 
0   NM_176739.1  CG33173-RA (CG33173), mRNA 
0   NM_176149.1  CG33145-RA, transcript variant A (CG33145), mRNA 
0   NM_176148.1  CG33145-RB, transcript variant B (CG33145), mRNA 
0   23  NM_132457.1  CG11122-RA (CG11122), mRNA 
0   NM_165675.1  CG11804-RA, transcript variant A (ced-6), mRNA 
0   NM_001031986.1  CG33719-RB, transcript variant B (Pif1A), mRNA 
0   NM_001031987.1  CG33719-RA, transcript variant A (Pif1A), mRNA 
0   NM_001031985.1  CG33720-RA, transcript variant A (Pif1B), mRNA 
0   NM_205875.1  CG32019-RE, transcript variant E (bt), mRNA 
0   NM_205876.1  CG32019-RC, transcript variant C (bt), mRNA 
0   NM_205877.1  CG32019-RD, transcript variant D (bt), mRNA 
0   NM_166790.2  CG32019-RA, transcript variant A (bt), mRNA 
0   NM_165426.1  CG10392-RA, transcript variant A (Ogt), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.