National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32341R-1 
 Symbol CG32341  Full Name CG32341 
 CG No CG32341  Old CG No CG32341 
 Synonyms BcDNA:SD01284, CG32341 
 Accession No (Link to NCBI) NM_167841.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGAAATTGTGCACGTGCAAAG 
 Primer Seq. 3'
aatctagaggtaccGAATGTATTGCCCTGAGCCTG 
 Predicted Fragment Size
483 
 IR fragment full Seq
0001 CGAAATTGTG CACGTGCAAA GCCAGGACAC GGTCGGCAAT CGGAGGACGA GACGGTCGAG 
0061 ATGGATGAGT GAGTTCCCGA CCGAGGANCT CGGCGCTCGG CGCTCGGAAC AACCCCCAAA 
0121 AGCAAATGTT GGGGTGTGTC GGAGTTAACG AGTTCAAATG TATTCATGAG CCGGATCTTA 
0181 CCAGCCAGCT GGCTGCNTAT GTGGGAGGTG TCGCATGGGG GAGCCCCAGC CCGCTGCCAA 
0241 AGTCCTCCCC CTCTCGAGGA TTTGGCTTCC TGCCAGCTGC GAGGGTTGCC TGTGCCTGTG 
0301 ACTGTTNCCG TTGCCTTTGC AACCCGACTT TCCTGACTTA TTGCCTCGCG GTCATGTGGG 
0361 AGGATGTGGC TCGGCNTAAA AGGCCCTCCT CCACTCAATG TTTTGCAATT TGCAGGTGTT 
0421 TTCATCATCA ATTTCGACCA GCTGTAGACA TTTTTGAACA AGCCAACAGG CTCAGGGCAA 
0481 TACATTC 
 in silico PCR Fragment
0001 CGAAATTGTG CACGTGCAAA GCCAGGACAC GGTCGGCAAT CGGAGGACGA GACGGTCGAG 
0061 ATGGATGAGT GAGTTCCCGG CCGAGGA-CT CGGCGCTCGG CGCTCGGAAC AACCCCCAAA 
0121 AGCAAATGTT GGGGTGTGTC GGAGTTAACG AGTTCAAATG TATTCATGAG CCGGATCTTA 
0181 CCAGCCAGCT GGCTGC-TAT GTGGGAGGTG TCGCATGGGG GAGCCCCAGC CCGCTGCCAA 
0241 AGTCCTCCCC CTCTCGAGGA TTTGGCTTCC TGCCAGCTGC GAGGGTTGCC TGTGCCTGTG 
0301 ACTGTT-CCG TTGCCTTTGC AACCCGACTT TCCTGACTTA TTGCCTCGCG GTCATGTGGG 
0361 AGGATGTGGC TCGGC-TAAA AGGCCCTCCT CCACTCAATG TTTTGCAATT TGCAGGTGTT 
0421 TTCATCATCA ATTTCGACCA GCTGTAGACA TTTTTGAACA AGCCAACAGG CTCAGGGCAA 
0481 TACATTC 
 Assemble Data

32341R-1.IR_full       1   CGAAATTGTGCACGTGCAAAGCCAGGACACGGTCGGCAATCGGAGGACGAGACGGTCGAG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32341R-1.in silico     1   CGAAATTGTGCACGTGCAAAGCCAGGACACGGTCGGCAATCGGAGGACGAGACGGTCGAG 60


32341R-1.IR_full       61  ATGGATGAGTGAGTTCCCGACCGAGGANCTCGGCGCTCGGCGCTCGGAACAACCCCCAAA 120
                           ||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||
32341R-1.in silico     61  ATGGATGAGTGAGTTCCCGGCCGAGGA-CTCGGCGCTCGGCGCTCGGAACAACCCCCAAA 120


32341R-1.IR_full       121 AGCAAATGTTGGGGTGTGTCGGAGTTAACGAGTTCAAATGTATTCATGAGCCGGATCTTA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32341R-1.in silico     121 AGCAAATGTTGGGGTGTGTCGGAGTTAACGAGTTCAAATGTATTCATGAGCCGGATCTTA 180


32341R-1.IR_full       181 CCAGCCAGCTGGCTGCNTATGTGGGAGGTGTCGCATGGGGGAGCCCCAGCCCGCTGCCAA 240
                           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
32341R-1.in silico     181 CCAGCCAGCTGGCTGC-TATGTGGGAGGTGTCGCATGGGGGAGCCCCAGCCCGCTGCCAA 240


32341R-1.IR_full       241 AGTCCTCCCCCTCTCGAGGATTTGGCTTCCTGCCAGCTGCGAGGGTTGCCTGTGCCTGTG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32341R-1.in silico     241 AGTCCTCCCCCTCTCGAGGATTTGGCTTCCTGCCAGCTGCGAGGGTTGCCTGTGCCTGTG 300


32341R-1.IR_full       301 ACTGTTNCCGTTGCCTTTGCAACCCGACTTTCCTGACTTATTGCCTCGCGGTCATGTGGG 360
                           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
32341R-1.in silico     301 ACTGTT-CCGTTGCCTTTGCAACCCGACTTTCCTGACTTATTGCCTCGCGGTCATGTGGG 360


32341R-1.IR_full       361 AGGATGTGGCTCGGCNTAAAAGGCCCTCCTCCACTCAATGTTTTGCAATTTGCAGGTGTT 420
                           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
32341R-1.in silico     361 AGGATGTGGCTCGGC-TAAAAGGCCCTCCTCCACTCAATGTTTTGCAATTTGCAGGTGTT 420


32341R-1.IR_full       421 TTCATCATCAATTTCGACCAGCTGTAGACATTTTTGAACAAGCCAACAGGCTCAGGGCAA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32341R-1.in silico     421 TTCATCATCAATTTCGACCAGCTGTAGACATTTTTGAACAAGCCAACAGGCTCAGGGCAA 480


32341R-1.IR_full       481 TACATTC 487
                           |||||||
32341R-1.in silico     481 TACATTC 487

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   465  NM_167841.1  CG32341-RA (CG32341), mRNA 
0   NM_141372.1  CG15593-RB, transcript variant B (Osi10), mRNA 
0   NM_169131.1  CG15593-RA, transcript variant A (Osi10), mRNA 
0   NM_133125.2  CG7537-RB (inx5), mRNA 
0   NM_176694.1  CG3126-RB, transcript variant B (C3G), mRNA 
0   NM_132122.2  CG3126-RA, transcript variant A (C3G), mRNA 
0   NM_165760.2  CG18408-RB, transcript variant B (CAP), mRNA 
0   NM_080317.2  CG2647-RA (per), mRNA 
0   10  NM_001043139.1  CG11282-RC, transcript variant C (caps), mRNA 
0   10  NM_079332.2  CG11282-RA, transcript variant A (caps), mRNA 
0   10  NM_168540.1  CG11282-RB, transcript variant B (caps), mRNA 
0   NM_080325.3  CG6450-RC (lva), mRNA 
0   NM_139582.1  CG12766-RA (CG12766), mRNA 
0   NM_137093.4  CG30069-RA (CG30069), mRNA 
0   NM_141097.2  CG14569-RA (CG14569), mRNA 
0   NM_133043.2  CG5744-RB, transcript variant B (Frq1), mRNA 
0   NM_001038764.1  CG5744-RC, transcript variant C (Frq1), mRNA 
0   NM_176739.1  CG33173-RA (CG33173), mRNA 
0   NM_176149.1  CG33145-RA, transcript variant A (CG33145), mRNA 
0   NM_176148.1  CG33145-RB, transcript variant B (CG33145), mRNA 
0   23  NM_132457.1  CG11122-RA (CG11122), mRNA 
0   NM_165675.1  CG11804-RA, transcript variant A (ced-6), mRNA 
0   NM_001031986.1  CG33719-RB, transcript variant B (Pif1A), mRNA 
0   NM_001031987.1  CG33719-RA, transcript variant A (Pif1A), mRNA 
0   NM_001031985.1  CG33720-RA, transcript variant A (Pif1B), mRNA 
0   NM_205875.1  CG32019-RE, transcript variant E (bt), mRNA 
0   NM_205876.1  CG32019-RC, transcript variant C (bt), mRNA 
0   NM_205877.1  CG32019-RD, transcript variant D (bt), mRNA 
0   NM_166790.2  CG32019-RA, transcript variant A (bt), mRNA 
0   NM_165426.1  CG10392-RA, transcript variant A (Ogt), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.