National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32311R-2 
 Symbol zormin  Full Name zormin 
 CG No CG33484  Old CG No CG32311 
 Synonyms CG5699, CT36990, CG32311, CG32310, CG32307, CG32309, CG11952, CG11953, CG1282, CG11850, CG33484, BcDNA:GH09541, zormin 
 Accession No (Link to NCBI) NM_206240.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Mummery-Widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA.
Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi.
Nature (2009) 458(7241) 987-92 [ PubMed ID = 19363474 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                            ||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| silico      1   AAGCAGGAGCAGCGCCAGAAGGAGCAAAGGGAGCGGGATGCTCGTGATCAAGCCGAACG 59

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GGAAAAGGCTATAAAGGAAGCAGAGGCCAAGGAAAGGTTGCACAGAGAAGAGCAATCCCG 119

                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ACTAGAAAACCAGCGCCAGCAGGCGGCCATTGAGCAGGCTCAACGGGAATTGGCAGCCAG 179

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AGAATTGGCTCTGAGGGAGCAAGCTGTCCGGGAGGAGGAGGCCAGATTGCAGGCCATTCG 239

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GGAGCAGGCCACGCGGGAACAATTGGCCAGGGAACAGGCTGCCCGGGAGGAGGAGCTGCG 299

                           |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| silico     301 TATACAATCGCTCAGAGATATTGCCCGCAGGGAAGAGGAAGTGCGTCTCCAAAACATCAG 359

                           |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GGATGAAGAAACCCGCATTCGCCGCGAGGAGGAGGAGCGTATCCGTAGAGAAAACGAGTC 419

                           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| || silico     421 ACGATCGAAACGAGAGGAGGAAGCCCGCATCCAGCGTGAGGAGATCACCAGACTCCAGAC 479

32311R-2.IR_full       481 CCTACGCGATCAATGTGGACC 500
                           ||||||||||||| ||||||| silico     481 CCTACGCGATCAA-GTGGACC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  33  NM_206240.1  CG33484-RA, transcript variant A (zormin), mRNA 
100   482  33  NM_001043112.1  CG33484-RB, transcript variant B (zormin), mRNA 
100   482  33  NM_001043114.1  CG33484-RD, transcript variant D (zormin), mRNA 
100   482  32  NM_001043113.1  CG33484-RC, transcript variant C (zormin), mRNA 
0.41   NM_057657.4  CG17158-RA (cpb), mRNA 
0.41   NM_057269.2  CG10236-RA (LanA), mRNA 
0.2   NM_140447.1  CG9598-RA (CG9598), mRNA 
0.2   NM_164746.1  CG4889-RB, transcript variant B (wg), mRNA 
0.2   NM_078778.3  CG4889-RA, transcript variant A (wg), mRNA 
0   NM_167963.1  CG32297-RA (CG32297), mRNA 
0   NM_057631.4  CG5786-RA (ppan), mRNA 
0   NM_132235.2  CG32717-RB, transcript variant B (sdt), mRNA 
0   NM_001038747.1  CG32717-RF, transcript variant F (sdt), mRNA 
0   NM_206652.1  CG32717-RD, transcript variant D (sdt), mRNA 
0   NM_001042798.1  CG32717-RH, transcript variant H (sdt), mRNA 
0   NM_206653.1  CG32717-RE, transcript variant E (sdt), mRNA 
0   NM_132236.3  CG32717-RA, transcript variant A (sdt), mRNA 
0   NM_164715.1  CG32828-RA (CG32828), mRNA 
0   NM_142135.1  CG14857-RA (CG14857), mRNA 
0   NM_140989.1  CG13251-RA (CG13251), mRNA 
0   NM_176736.1  CG15643-RA (CG15643), mRNA 
0   20  NM_166535.1  CG4444-RA (px), mRNA 
0   NM_143812.2  CG7480-RA (Pgant35A), mRNA 
0   NM_206667.1  CG10701-RG, transcript variant G (Moe), mRNA 
0   NM_206668.1  CG10701-RF, transcript variant F (Moe), mRNA 
0   NM_206666.1  CG10701-RH, transcript variant H (Moe), mRNA 
0   NM_206669.1  CG10701-RE, transcript variant E (Moe), mRNA 
0   NM_206665.1  CG10701-RI, transcript variant I (Moe), mRNA 
0   NM_206664.1  CG10701-RJ, transcript variant J (Moe), mRNA 
0   NM_167170.1  CG10701-RC, transcript variant C (Moe), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.